SGN Marker solcap_snp_sl_9832

SGN-M26266

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 74543)
Chromosome
4
Position
3.29 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 70056)
Chromosome
4
Position
8.72 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 66368)
Chromosome
4
Position
4.81 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 62597)
Chromosome
4
Position
0.74 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
CTGAGGAGATTTCTGCTTTGAAAAACCTTGAAAATTTATCATCATTTTTC
  
3' flanking region
GATTCACTCTCCCCCAAAATCCACACAAAAACAATGAAATACAGTTGAAA
SNP nucleotide
AT
SNPdb format
CTGAGGAGATTTCTGCTTTGAAAAACCTTGAAAATTTATCATCATTTTTC[A/T]
GATTCACTCTCCCCCAAAATCCACACAAAAACAATGAAATACAGTTGAAA
  
Genomic location of solcap_snp_sl_9832  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D26266 marker 26266
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)