SGN Marker solcap_snp_sl_9837

SGN-M26271

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 74545)
Chromosome
4
Position
3.85 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 70057)
Chromosome
4
Position
9.35 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 66369)
Chromosome
4
Position
4.81 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 62602)
Chromosome
4
Position
0.78 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
GAGAGTTTTTGGCAAGGGAAGTTGTCCTGATGAATTAAAAGATGTTGGAG
  
3' flanking region
AAGAATTGCAGGAAACTGTGGTGGAGTACCACTTATTGTAGTTGTCATTG
SNP nucleotide
AT
SNPdb format
GAGAGTTTTTGGCAAGGGAAGTTGTCCTGATGAATTAAAAGATGTTGGAG[A/T]
AAGAATTGCAGGAAACTGTGGTGGAGTACCACTTATTGTAGTTGTCATTG
  
Genomic location of solcap_snp_sl_9837  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D26271 marker 26271
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)