SGN Marker solcap_snp_sl_9849

SGN-M26282

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 74550)
Chromosome
4
Position
4.12 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 70059)
Chromosome
4
Position
10.61 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 62613)
Chromosome
4
Position
0.82 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
GGAAGAATATGCTGTAAAGAAAGCTCAGGACTAAGAATCTGACTGAATTT
  
3' flanking region
GTGGCTTTCCCTGCAGCAGCTATACGCACTTCCGCTTCATTATCCCGCAG
SNP nucleotide
TG
SNPdb format
GGAAGAATATGCTGTAAAGAAAGCTCAGGACTAAGAATCTGACTGAATTT[T/G]
GTGGCTTTCCCTGCAGCAGCTATACGCACTTCCGCTTCATTATCCCGCAG
  
Genomic location of solcap_snp_sl_9849  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D26282 marker 26282
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)