SGN Marker TG369

SGN-M264

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1600
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
TG369 image not available
Forward sequence
CTAAAAATGAAACAAGCTTTTCAAATTTGTGTTACCAACCAAAGCTGCAATGGTTGTTGGGAACAACATTAGTTTCTTTTTTCTTATTGT
AATAGAGGACCAACAGCCTACACAAGTTCATATCTGCTTCAAGGATTAATGATTAAATTTACTGAAAGCACAGTAGGTGATTATGACTAC
AACCAGACAAACTAGTCAGCAATAGTTAATCTTGTGACGTACTTTTGGATTCTAGAAACTGTGAGCTAAGGAGTCTGAATGTTGTGTGGA
TCAGTTGTAAAAAAGAACTTTGTATCTTTCCTTTGATAAAATGGGTGATGTGAAGATAGTTTAGCTTATATTGCCACAGGTACTTGTATA
TGGAAAGAACTTGGTGAAAACCTCTACTTGTAACTGATTCTGGTATGGTCTATTCTCTTTGGACTTTTATTTGTTCCTTGAATTTGATAT
GGTATTTTATTCTTCACTATTATTCTTATTTGTTCCAAATATGTGGCATCCTTGTCTAGTA
Reverse sequence
CTCACTATAGGGAGACAGCTTGCATGCCTGCAGGTAATACATATCATTAAGATATTAAACTTAGAAATTCGTGAGATTTTAGCCAATGGC
GGTGCCTTGAGCCACTAAATCTTTTGTATTCTACTACTATTCCTTAAAGGATAACCTTTTTATTAATATTAACCCAATAACAGTAGCTTC
TTAATTCAAGCATATTGGAGTTTACCTACCTTTCATATACTAAGTAGAAGTCTGTAAGTTTGGATACATTATTAGTGATATAAATATTGG
ATAAATTATGTATTCTCACAACGACCAATTTGATTGGTCTTTGAGCTAAACTTTGTTTAAATTTTGATTTACTTAAAAATTTATCGAGTA
CTAGGAGAGCTAAACGAAACATCAATACCAGGCGCATTTTATATTTCAAAATATTTATCTATCTGTCTATCGATTAAAATTGGTTATATA
CTAGAATCTAAGGATTTTTGTGAGGGCTATACGCTTGGCCCATACTTTGGTTTTGCTTATTTTGATGGGCCTAGAATATCTTGTATATTT
GGACCATGTTTAGACTGTTAGCT
RFLP sequence matches to unigenesNone
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 40016)
Chromosome
1
Position
149.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8756)
Chromosome
1
Position
117.20 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
TG369 was used as an overgo probe on plate 5 [well A8]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
GTGTTACCAACCAAAGCTGCAATG
B sequence
TGTTGTTCCCAACAACCATTGCAG
AB sequence
GTGTTACCAACCAAAGCTGCAATGGTTGTT
Marker sequence
CTAAAAATGAAACAAGCTTTTCAAATTTGTGTTACCAACCAAAGCTGCAA
TGGTTGTTGGGAACAACATTAGTTTCTTTTTTCTTATTGTAATAGAGGAC
CAACAGCCTACACAAGTTCATATCTGCTTCAAGGATTAATGATTAAATTT
ACTGAAAGCACAGTAGGTGATTATGACTACAACCAGACAAACTAGTCAGC
AATAGTTAATCTTGTGACGTACTTTTGGATTCTAGAAACTGTGAGCTAAG
GAGTCTGAATGTTGTGTGGATCAGTTGTAAAAAAGAACTTTGTATCTTTC
CTTTGATAAAATGGGTGATGTGAAGATAGTTTAGCTTATATTGCCACAGG
TACTTGTATATGGAAAGAACTTGGTGAAAACCTCTACTTGTAACTGATTC
TGGTATGGTCTATTCTCTTTGGACTTTTATTTGTTCCTTGAATTTGATAT
GGTATTTTATTCTTCACTATTATTCTTATTTGTTCCAAATATGTGGCATC
CTTGTCTAGTA
Genomic location of TG369  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D264 marker 264
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)