SGN Marker TG516

SGN-M271

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1800
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
Forward sequence
TGGCAACTCACATACAAATGCAAAAGGCTAGGCCAGGAATTGGTATTTTGATCTGGTCCTCCAAAGTTCTATATTATCAGTTGCTTGATC
TTGATACATATTCATTTCCTTTATCTTGTATTCTAGGTGGATCAAGGTGAAACTGTTGGGGAGACAGATTTGTCACAGGATGAGTCCAGT
ATACTCGATTTTCCTGTCGATATTTTATCTTTGGAGGCTTCATCCAAAAAGGGTCTGATTTCTGCTTCTGAGATGGAGAGAAGTAATGGC
GAAGACCTTGCTTTGATGCCTTTGGATGCATTTGATGGCAAAGACATTTCTTCTTTGGACACTTTTAAGGAACCATATTTAATATCTGAA
GAAAAAAGAGTTTTTTCTATAGAAAATCCGAAGGATATGATTGCACGGTGGGAGATAGATAATTTGGATGTCAAAACA
Reverse sequence
GGAGACAGCTTGCATGCCTGCAGTACATGTGAAGAGACATATGATGATGTAAAGTTCTTGAGTGACGGTCAAGAGGCACTTCGCAAAACT
GAATACTATTTTATAATTGGACAAGTCAAATAATGTAGAAAAAAGTTTGTTAATGCATTGAAGCATAAACTGTAAAGATTGCAGTTTCTA
GATCTTAATGTGGCATTATATCAGAAAGAGATCTGTTTGGTTAATAAAAATTCAAAATAAATTCTTGGAACTGAAAAAAAAGGGATCCGA
GTACAAAATATCATAGAGATATATTTTCTGAAAATCAGAGAAGAGATTGATGGTTGAGAGCTTCAATCTTCTTAAATCAGAGAAAAGATT
GGAGATTAAAGCAGGAGAGTAAGTGAAAAATTTTAACCCGCAGAGTCTTAAACCCGCCGTACCCCGCCCAGTCCCATTGCCATCCCTACT
TATGACCAACTTCCTAGCCCAAGTTTACCCAACTCATCATTACCTA
RFLP sequence matches to unigenesNone
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 40072)
Chromosome
4
Position
56.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8777)
Chromosome
4
Position
46.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
TG516 was used as an overgo probe on plate 8 [well E7]

Plausible BAC Matches:   P002J01,   P261E06

 Overgo Sequences

A sequence
GGTCTGATTTCTGCTTCTGAGATG
B sequence
CGCCATTACTTCTCTCCATCTCAG
AB sequence
GGTCTGATTTCTGCTTCTGAGATGGAGAGA
Marker sequence
TGGCAACTCACATACAAATGCAAAAGGCTAGGCCAGGAATTGGTATTTTG
ATCTGGTCCTCCAAAGTTCTATATTATCAGTTGCTTGATCTTGATACATA
TTCATTTCCTTTATCTTGTATTCTAGGTGGATCAAGGTGAAACTGTTGGG
GAGACAGATTTGTCACAGGATGAGTCCAGTATACTCGATTTTCCTGTCGA
TATTTTATCTTTGGAGGCTTCATCCAAAAAGGGTCTGATTTCTGCTTCTG
AGATGGAGAGAAGTAATGGCGAAGACCTTGCTTTGATGCCTTTGGATGCA
TTTGATGGCAAAGACATTTCTTCTTTGGACACTTTTAAGGAACCATATTT
AATATCTGAAGAAAAAAGAGTTTTTTCTATAGAAAATCCGAAGGATATGA
TTGCACGGTGGGAGATAGATAATTTGGATGTCAAAACA
Genomic location of TG516  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D271 marker 271
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)