SGN Marker TG517

SGN-M273

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
2200
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
Forward sequence
TTCCACAATCTCGACTTTTCTTTCTCTGCCCCTTTTCCTATACCAAGTCTCACTTTTCTTTCCCTTTCAAGATACCCTAGGATTCAACAT
AGGTTTTTTTTTCTCTTCATATTAACTAATCATACGTATTAAGACAAATAAATTGAAACGGAGTATATATATACATATATATTTATAATT
AAAAGAAAGTGTAAATAGAACAGATCTAGTTGTAGAGCTAGCAAAGTAATGGTGGTTTCATTTTCTCAATACTCTCTATTGTTGTGAGTA
AGTAATTATTTTTTTTCCCCCATCCATCTGGGGCCCTTATTGAAGAGATGGATGAAAACAAAGGAGATACCACCAAGAAACAACATTTAT
CTAACTCTCCAGTTGACCCTCATGAACAAGATTCACCAGATAATACTATTCCGCTACAGCATCCGGTTGTTTCTGCTGCTCCTTATATTT
CTTCTTC
Reverse sequence
GGAGACAGCTTGCATGCCTGCAGAATAATTTTTAATTATTTAAATTTCAGTTAAGGAGAGCACTATTCATGGGAACCATGGTATAGACTA
ATATTAAATTCATTTAGCTTACAACAGGAAGAAATAGAAAATCTAATGATTGCCTTTACACAAATAGAAAATTCTAAATTTTATGGAAGA
GACTTACATCTGATGGGAAATTCAGAAGAGGGAAGCTGCAATCTTTCACTTGGACCTAAAAAATTGAATAGAAAATTTTAAACTAGGAAC
AAATAAATGGACTTTGAGCAATTAAATGAAAATGAAAATTAAAATACCACAAGGAGCAATAGGTGAAGAAGATTTTCTTCTGCCAAAGAC
TTTGAGTTGTATCCCAGATTGGAATCTATCAACAGAAAAGCCTTTCATTGGTCCATCTTCAAAGGCCTCCATAGTGCTAGCCACCATAGA
ATCATCCAAAAATGCAATTTCATCTGCATTTAAAAAACTGCAACC
RFLP sequence matches to unigenesNone
Mapped locations  
Map: Eggplant-COSII   
Map version
63 (location: 42481)
Chromosome
3
Position
64.70 cM
Confidence
I(LOD2)
Protocol
RFLP


Eggplant-COSII

Map: Pepper-COSII   
Map version
58 (location: 41635)
Chromosome
3
Position
55.10 cM
Confidence
I(LOD2)
Protocol
dCAPS


Pepper-COSII

PCR data   Exp. ID 43594
Forward primer (5'-3')
CTTCTTCTGCTCAGCAGCAACATCATGA
Accessions and product sizes
Approximate temperature
60°C
Reverse primer (5'-3')
TTTATCGGCTCTCGTTTTGC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 40073)
Chromosome
3
Position
32.00 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 2000

Map: Eggplant-LXM 2002   
Map version
29 (location: 8783)
Chromosome
3
Position
69.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-LXM 2002

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8782)
Chromosome
3
Position
24.20 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
TG517 was used as an overgo probe on plate 2 [well G1]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
ACTATTCCGCTACAGCATCCGGTT
B sequence
AAGGAGCAGCAGAAACAACCGGAT
AB sequence
ACTATTCCGCTACAGCATCCGGTTGTTTCT
Marker sequence
TTCCACAATCTCGACTTTTCTTTCTCTGCCCCTTTTCCTATACCAAGTCT
CACTTTTCTTTCCCTTTCAAGATACCCTAGGATTCAACATAGGTTTTTTT
TTCTCTTCATATTAACTAATCATACGTATTAAGACAAATAAATTGAAACG
GAGTATATATATACATATATATTTATAATTAAAAGAAAGTGTAAATAGAA
CAGATCTAGTTGTAGAGCTAGCAAAGTAATGGTGGTTTCATTTTCTCAAT
ACTCTCTATTGTTGTGAGTAAGTAATTATTTTTTTTCCCCCATCCATCTG
GGGCCCTTATTGAAGAGATGGATGAAAACAAAGGAGATACCACCAAGAAA
CAACATTTATCTAACTCTCCAGTTGACCCTCATGAACAAGATTCACCAGA
TAATACTATTCCGCTACAGCATCCGGTTGTTTCTGCTGCTCCTTATATTT
CTTCTTC
Genomic location of TG517  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D273 marker 273
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)