SGN Marker TG519

SGN-M275

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1800
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
TG519 image not available
Forward sequence
AATCAGGGAGACTGATGATATTGTGGAAAAAATTGGTAAGACCTTTTTATTTGCCAAGTTTATATCATTTCGAATATTGACTGGAGCCTG
CTGCTGAAATTTTGGTCATTGAACAGATAAAATATTTAATGAACCAGATTATTACTATTATTATATAATAAATTCCTTTTTCATTGAGAA
GATTTACCCTTGAAAGACAATTTATCATTTCTGATACAGAGTCTGATGGCTCAATACTTCTTATGCATTTAAGTGTATTTCTGTCATTTC
TACATTTGTTTTCTCATCTAACTCGTGGCATTTAGCTTATATTTGGATCAGAAACATTACTTCATTTTTAGAGTTTGCTCATGATTGTGT
CTCCAAAGAATTGCATATGTTTAATGTGTATGCACTTTCAGAGCTATCATTGATCTTGCATCAACATTTCTTTTGTTTAATCTCCGGTTG
GAG
Reverse sequence
GGAGACAGCTTGCATGCCTGCAGCTGTCTAACAATAATTGAAAACAAAAGCTAAGTAATTATGGTGACTTTCTTCTACAAGTTCAATGAT
AAAGGAGAATATATAAATTTTTTCATGAAGAAAGATGGAATTCTCTAGACACAAATCACAAACTTCTTACTTCAAAAAAGCAAATCTTAA
ATCAATCAGAACAAGTTTTGCAACATAGATTCCGTCAATAGCCTTGGTCTTTCTTACATACATGGGTCCAAGTTGAATACAAATACGTGG
AAAGGTGTCTCATTTTCCTAGGCCCTTATTTCAGGTGTGGGGACAGAGCGGAAACTTGTATGTTATTAAGAACTAGCATATAAAGTACAA
AGGCCATTCAATATGAGCACTTAACTGTTCTTTCGGTCTTTTCTTTAGATATCAGCTTCAGATGAAGCTAGAAACCCTAATTTTATTCAG
CTCTTCTATCTCCCTTCATCTTTGGCAAAGCTCCCTAATAATTTAAAAAGA
RFLP sequence matches to unigenesNone
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 40075)
Chromosome
4
Position
75.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8790)
Chromosome
4
Position
58.40 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
TG519 was used as an overgo probe on plate 9 [well F11]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
TATTGACTGGAGCCTGCTGCTGAA
B sequence
GTTCAATGACCAAAATTTCAGCAG
AB sequence
TATTGACTGGAGCCTGCTGCTGAAATTTTG
Marker sequence
AATCAGGGAGACTGATGATATTGTGGAAAAAATTGGTAAGACCTTTTTAT
TTGCCAAGTTTATATCATTTCGAATATTGACTGGAGCCTGCTGCTGAAAT
TTTGGTCATTGAACAGATAAAATATTTAATGAACCAGATTATTACTATTA
TTATATAATAAATTCCTTTTTCATTGAGAAGATTTACCCTTGAAAGACAA
TTTATCATTTCTGATACAGAGTCTGATGGCTCAATACTTCTTATGCATTT
AAGTGTATTTCTGTCATTTCTACATTTGTTTTCTCATCTAACTCGTGGCA
TTTAGCTTATATTTGGATCAGAAACATTACTTCATTTTTAGAGTTTGCTC
ATGATTGTGTCTCCAAAGAATTGCATATGTTTAATGTGTATGCACTTTCA
GAGCTATCATTGATCTTGCATCAACATTTCTTTTGTTTAATCTCCGGTTG
GAG
Genomic location of TG519  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D275 marker 275
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)