SGN Marker TG373

SGN-M276

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
900
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
TG373 image not available
Forward sequence
CTGAGAGATCCTCACACACCAAAGAAAGCAATTCCCAAAATCCAGTAAAAAACAACGTAAAAGGAAGAACTCGCCATCACAAGAAGAGGT
AAACTTATGTTGATCATTAATTCAATCTGGCTTTTAGTTATTAATATTAGCCAACGTACAGTAAGTGCTTACTAAAGTGTGAATGTAGGT
TTTTTGGAATATTATGTCAATCCAAGTGAAGTGTTTTTTCTATCCCTTATTTCTCCTCAAGCTTCTTTGAAACTCAAACTGATTCTAAAT
GGAAGTTCTCCTAGGCATTAATTTATGATAATTGGATCTTTTTATATCCTCTTAAATTAGTCCTTTTTACCCTGCACGACAACCATTCTG
GTCTCTAGTGTTCAGTGTGCCATTGTGAATGGCAAACTGCTACGGAAGTTTACATGAGAAAGTGAACCCATAAAGCATGCATGGCGAAGT
GATAGAAATCTCAAAAACTTAGTATTAGTATTTATTTCATAACACCTT
Reverse sequence
GGAGACAAGCTTGCATGCCTGCAGCCAAGTTACATCAAGCTCGACATCCACGGCAGCAGAGACAAAAGACTTCATCTCTTTGATGGAAGA
AGAACCAATATCACTGTTTTCGAGCCTCTTTACAACATTCACAAACCAGATCAAGAAGGGAAGCTATGGAAGCCAATGATGTATAGTGAC
AGTTGACTGCAATGTCATCATACTCGGCAAAAATGGCAGTAAATGTGGGAGCACTGGTTACTTTTACTTTTGGAGTTAAATTATGCTGCA
TGGTCCTACATAAAATGTTGTTCAGCTGGAATCACATTCTTTATGGGGTCTAAATGTGATATAAATAACTTCCACTGTTGGAGGAGTCTG
ATGATCAGTTGCTTTTCCCTGCCAAGTTTTCGAGCATAGAAAGGTGTTATGAAATAAATACTAATATTAAGTTTTTGAGATTTCTATCAC
TTCGCCATGCATGCTTTCTGGGTTCACTTTCTCATCTAAACTTCCGTAGCAGTTTGCCATTCACAATGGCACACTGAACACTAGAGACCA
GAATGGTTGTCGTGCA
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1580141.4e-0736 (7.2% of RFLP seq)+
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 40018)
Chromosome
2
Position
94.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8793)
Chromosome
2
Position
79.50 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
TG373 was used as an overgo probe on plate 6 [well C5]

Plausible BAC Matches:   P011A02,   P011L15,   P176K23,   P095L08,   P323M23,   P306N19,   P264H24,   P050K01,   P046L13,   P092N09,   P185M24

 Overgo Sequences

A sequence
TGCACGACAACCATTCTGGTCTCT
B sequence
TGGCACACTGAACACTAGAGACCA
AB sequence
TGCACGACAACCATTCTGGTCTCTAGTGTT
Marker sequence
CTGAGAGATCCTCACACACCAAAGAAAGCAATTCCCAAAATCCAGTAAAA
AACAACGTAAAAGGAAGAACTCGCCATCACAAGAAGAGGTAAACTTATGT
TGATCATTAATTCAATCTGGCTTTTAGTTATTAATATTAGCCAACGTACA
GTAAGTGCTTACTAAAGTGTGAATGTAGGTTTTTTGGAATATTATGTCAA
TCCAAGTGAAGTGTTTTTTCTATCCCTTATTTCTCCTCAAGCTTCTTTGA
AACTCAAACTGATTCTAAATGGAAGTTCTCCTAGGCATTAATTTATGATA
ATTGGATCTTTTTATATCCTCTTAAATTAGTCCTTTTTACCCTGCACGAC
AACCATTCTGGTCTCTAGTGTTCAGTGTGCCATTGTGAATGGCAAACTGC
TACGGAAGTTTACATGAGAAAGTGAACCCATAAAGCATGCATGGCGAAGT
GATAGAAATCTCAAAAACTTAGTATTAGTATTTATTTCATAACACCTT
Genomic location of TG373  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D276 marker 276
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)