SGN Marker TG376

SGN-M279

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1300
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
TG376 image not available
Forward sequence
ATAATACATGATCCTGAATTCAGTCACTTCTTTAAAGTCTGTGAATTCATAAGTTGGTCATTAACTATAGATGAACTTAATGGTAAAAGG
GAACATTTAGTGGGGAATTCAAAATCATGAAGCGCAGTTAAAATATGTGTTGTTCATCTTTCCCGTGTGCTGGTACAAGCACGACTGCAC
AAGACAGTGCAAATATGAAAATAATATGTCTTTTGAGGAAGTAAAGAAGAAAGTCTCAATCTTATGTGAGACCTGAGTTTTCTTTCAAAT
TTTAGGTGCTTATGGATTTTATGCATCTGTAGTTCCCCTTTTCTTCCTTAGTTTTCGATGAGATGGAATTTTGCACAAATGAAGAATAAC
CTCTTGTCCGATATTTCTTTTTGGCGGCACCCATGAGGTTCCTTTATGTATAGATGATTACGACCGCATCTTTTTT
Reverse sequence
ATAGATTGTCCAAACGGGGAACTAGATCAAGCATTAATCAGTCAACATAAAGTCATAATGCTTGATCGCAAATAGGCAAGGAACTCTTTT
TCATCATGGTTATCTGGTTAAACAGTGGATTCATTTGAACAGTACCACACAAATTTAGAGTGAATAATACCACAAATTTCATGTTCCCTA
GTGCATAAGGCTACGCCCTCATTGTAGTCCCACTGTTACAAATTCACTAGACAGTGCAACCTTCATGTATTCTTTTAATAGCGGACCATG
AATAACCTAAGTGTTAACTAATTGAATTCTCCAAAATGCAGATATGTATTTATTTGGAGAACAGGAAGAAGAAAAAGAGGATAACTTGTA
AATTGCCATGGTGAAGCACCTTAATGTTGCTTTAATAATAGAGCAGCTAGCTTAAACAAAGATTTGCAGTCAGAAACAAACAGAAAAAGT
AATATTCAAGCAAGTACAACAAAAATGAACATCTCACAAGGAATACCTCAAGACCTTCAACT
RFLP sequence matches to unigenesNone
Mapped locations  
Map: Tomato-EXPEN 1992   
Map version
28 (location: 8799)
Chromosome
1
Position
62.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
TG376 was used as an overgo probe on plate 14 [well A8]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
ATCTTTCCCGTGTGCTGGTACAAG
B sequence
GTCTTGTGCAGTCGTGCTTGTACC
AB sequence
ATCTTTCCCGTGTGCTGGTACAAGCACGAC
Marker sequence
ATAATACATGATCCTGAATTCAGTCACTTCTTTAAAGTCTGTGAATTCAT
AAGTTGGTCATTAACTATAGATGAACTTAATGGTAAAAGGGAACATTTAG
TGGGGAATTCAAAATCATGAAGCGCAGTTAAAATATGTGTTGTTCATCTT
TCCCGTGTGCTGGTACAAGCACGACTGCACAAGACAGTGCAAATATGAAA
ATAATATGTCTTTTGAGGAAGTAAAGAAGAAAGTCTCAATCTTATGTGAG
ACCTGAGTTTTCTTTCAAATTTTAGGTGCTTATGGATTTTATGCATCTGT
AGTTCCCCTTTTCTTCCTTAGTTTTCGATGAGATGGAATTTTGCACAAAT
GAAGAATAACCTCTTGTCCGATATTTCTTTTTGGCGGCACCCATGAGGTT
CCTTTATGTATAGATGATTACGACCGCATCTTTTTT
Genomic location of TG376  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D279 marker 279
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)