SGN Marker TG308

SGN-M28

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1500
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
TG308 image not available
Forward sequence
CTCCATTGGTGGATCAACCACACTTTTCTTGAAAATTGCCAACATTTTCTTTCTTCTCAAACAAAATCTATGAAAAAGTAAATTAGTGAG
AAAGCACAAACAAGGTGATAAACTTTGGTACAAAATGTATGAAATGATAAGTGGTTAGATGAGTATTTATAGCTAAAAGGGTTGGAGGAG
ACAAAAGGTGTCAAACATTATCCATTAATAATTTTGAGATGGAGAGAAAGTTAAGTTAATTATATAAAAATGGGCACGTGGGGCCACTGG
TTGTTTTTAAGGATTTTAGTGGGGCCTTAGAATAAAAAAAAAGTCACCCCCCTTCTCTTCTCTTAACTTGAGGTGGATGACATGTAACCG
ATTAAAAATTATGATTGTTTTT
Reverse sequence
ATTTCTCGAGTACTCTGACACTATCGATTGCACGAAAGCAAAGGCAGCACTTGGTGGCAGGAAATTTGGAGGGAATACTGCTGTTGCCAT
TTTTTATCCTGAAGACAAATGCTACAAGAAGGATTATGCCTCTTAATTTTCTGAATATCTTCCATGTTTATAGTCTTGTATAGTTTTAGT
GCTTGCAATCGGCCATTTAGCTGCGGTCAAGGCTGTTCGATAATTATTTTTCTTCCATCACAATTGCAACGCTAACCCAGCCATATGGTG
GGTGGTTTGAGCTGCTTGATATAGTCTCTCTATTAGGAGAAGTTTTTCATGTTTCAAACTATTGTAATGACCAGATTTTGGATATATCTA
TATAATTCTCAATATTACTAAAATATAAGCCTTGTTCAACTATTAGTTGATACCAATTTCATGTGATTTTAAATCATTTCTAGTACTAAT
ACTTTTCAATTTTATTCGATTGCAGATTCATCTAAATATTGATATTTCAATAATATTCATTTCCTTTATTAATTAGTTGAGGTTAAAATA
ACCCAATATTCATCTCAATATAAGTACTAATGTTAACCTAACACAAAGAGAGCAAGGAGAATGAGATCTCTTTCT
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1443622.7e-0548 (12.6% of RFLP seq)+
SGN-U1471842.1e-58113 (29.6% of RFLP seq)+
SGN-U159215383 (62.3% of RFLP seq)-
Mapped locations  
Map: Tomato QTL map   
Map version
137 (location: 53883)
Chromosome
2
Position
40.60 cM
Confidence
uncalculated
Protocol
RFLP

Dry_matter_weight_dmw2_1 Titratable_acidity_ta2_1 Eugenol_content_eug2_1 Fruit_weight_fw2_1Soluble_solid_content_ssc2_1 Sugar_content_suc2_1 3_Methylthio_propanal_content_mta2_1 Hex_3_en_1_ol_content__x3o2_1 Fruit_diameter_fd2_1 Color_a_a2_1 Dry_matter_weight_dmw2_2 Sugar_content_suc2_2 Soluble_solid_content_ssc2_2 Color_L_L2_1 Fruit_weight_fw2_2Titratable_acidity_ta2_2 Dry_matter_weight_dmw2_3 Color_b_b2_1Fruit_diameter_fd2_2 Elasticity_ela2_1 Carotene_content_car2_1 2_Isobutylthiazole_content_ibt2_1
Tomato QTL map

Map: Tomato-EXHIR 1997   
Map version
32 (location: 7799)
Chromosome
2
Position
39.30 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXHIR 1997

Map: Tomato-EXPEN 1992   
Map version
28 (location: 7800)
Chromosome
2
Position
55.60 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992

Map: Tomato-EXPIMP 2001   
Map version
26 (location: 7801)
Chromosome
2
Position
54.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPIMP 2001
Overgo hybridization and physical mapping 
TG308 was used as an overgo probe on plate 16 [well E12]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

P214J11,   P286D03,   P309P03,   P318A18

 Overgo Sequences

A sequence
CCTTCTCTTCTCTTAACTTGAGGT
B sequence
CGGTTACATGTCATCCACCTCAAG
AB sequence
CCTTCTCTTCTCTTAACTTGAGGTGGATGA
Marker sequence
CTCCATTGGTGGATCAACCACACTTTTCTTGAAAATTGCCAACATTTTCT
TTCTTCTCAAACAAAATCTATGAAAAAGTAAATTAGTGAGAAAGCACAAA
CAAGGTGATAAACTTTGGTACAAAATGTATGAAATGATAAGTGGTTAGAT
GAGTATTTATAGCTAAAAGGGTTGGAGGAGACAAAAGGTGTCAAACATTA
TCCATTAATAATTTTGAGATGGAGAGAAAGTTAAGTTAATTATATAAAAA
TGGGCACGTGGGGCCACTGGTTGTTTTTAAGGATTTTAGTGGGGCCTTAG
AATAAAAAAAAAGTCACCCCCCTTCTCTTCTCTTAACTTGAGGTGGATGA
CATGTAACCGATTAAAAATTATGATTGTTTTT
Genomic location of TG308  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D28 marker 28
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)