SGN Marker TG377

SGN-M280

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1300
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
Forward sequence
TTCTCTCCGTCTTTTTCCCTTTCCTAGTCCCGTCGCATCAGAGACTAAGACTCCTGCAAATAAATTGGCCCTTTCTTACTCTCTGTATTG
AACCCCGTGGTTATAACTTCTTCATGTACAACTTTGGATCAAATGATATGACTTCCATCGATTTTTTTGTTGCTTGCTAGCAGTTCTTTG
GTCATTGATGAATTACATTCTTGTTCTGAAGAGTACACATTTATTTGTTGGTTCGTTGTTGAAAAATTAAGCTTTGCAAACTTCTGAGGA
AGTAGCAGCAGAACAGAGTAAAGCACCAAGGTCAAATTATATGGGTTTAAAACTGATTTAACAGCTTATCTAAACATGTTCATTATGAGA
TCATTACTTTTTTTTTAACGAAACTAACTGGAGGATGTAACCTACTACTTTTTAGGATTGTTTGGGATGTTTTTTGTTTAACATGAATAT
AGAATGATGTGGGTTGGGAGTTTGGGATATAGTTAAGGGATACTTTTGGCCATTTAACT
Reverse sequence
ACTCACTATAGGGAGACAGCTTGCATGCCTGCAGACACCTATTGTGGCAGACTCCAACCAGTACACTAGGCTATTACAAGTCTTGGTTAA
CATCGGGTTGATTCTTAATGTACGCAAATATATTCTAAATAAGCTTTATATATTTTGATGATTGTTAATATCAAGTCAATGTGGTGCATA
TATTCTATGATTGCTGAATATATTGGACTGGACTGGTCACATTCTAATCCTCAACCAACCTTCCCACCTCTTAATCTAATCCTTTTTCTC
CTGCCTCCTTTTTGTATGTCTTAATCTTACATTCCTTAACTTCTTGGTTTTCCTTTACCCAACATGTTTCTGAGTTCCCTGGGGTGAAGG
GGGAGGATTTTGAGTCCAAATTCGGCCACAAAAAATAAGTAGGAACTCATACATAAAACTACCCAATTCTTACACGCTATAAGGGATATG
CATAACATAATATTTTACTCTCTTAATATGGGGTGAGTGGGGGGATGGGCAAAGTAGGAACACAAAAAGAAGCAAATACTCACATGGTAC
AGTACTTCCCTTCGTAAGTAAT
RFLP sequence matches to unigenesNone
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 40019)
Chromosome
3
Position
129.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8800)
Chromosome
3
Position
97.00 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
TG377 was used as an overgo probe on plate 2 [well D9]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
CTTCTGAGGAAGTAGCAGCAGAAC
B sequence
CTTGGTGCTTTACTCTGTTCTGCT
AB sequence
CTTCTGAGGAAGTAGCAGCAGAACAGAGTA
Marker sequence
TTCTCTCCGTCTTTTTCCCTTTCCTAGTCCCGTCGCATCAGAGACTAAGA
CTCCTGCAAATAAATTGGCCCTTTCTTACTCTCTGTATTGAACCCCGTGG
TTATAACTTCTTCATGTACAACTTTGGATCAAATGATATGACTTCCATCG
ATTTTTTTGTTGCTTGCTAGCAGTTCTTTGGTCATTGATGAATTACATTC
TTGTTCTGAAGAGTACACATTTATTTGTTGGTTCGTTGTTGAAAAATTAA
GCTTTGCAAACTTCTGAGGAAGTAGCAGCAGAACAGAGTAAAGCACCAAG
GTCAAATTATATGGGTTTAAAACTGATTTAACAGCTTATCTAAACATGTT
CATTATGAGATCATTACTTTTTTTTTAACGAAACTAACTGGAGGATGTAA
CCTACTACTTTTTAGGATTGTTTGGGATGTTTTTTGTTTAACATGAATAT
AGAATGATGTGGGTTGGGAGTTTGGGATATAGTTAAGGGATACTTTTGGC
CATTTAACT
Genomic location of TG377  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D280 marker 280
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)