SGN Marker cSTA-6-E19

SGN-M2914

SynonymsNone
Locus associationsNone
Derivations 
This marker was derived from EST clone SGN-C215899
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 51121)
Chromosome
1
Position
68.67 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 49056)
Chromosome
1
Position
40.64 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 40478)
Chromosome
1
Position
37.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
cSTA-6-E19 was used as an overgo probe on plate 11 [well C3]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
CTTTTGGTGGACTCAATTCACCTC
B sequence
GCGGCAGCAAAATGAAGAGGTGAA
AB sequence
CTTTTGGTGGACTCAATTCACCTCTTCATT
Marker sequence
GGAGAAAATGGGTAATTCTTTTGGGTGTTCGGCCTCCGGTGAACGGTTGG
TATCGGCGGCCAGAGACGGCGATTATGTAGAAGCGAAGATGTTGCTTGAT
TGCAATCCATGTCTTTCAAAGTACTCTACTTTTGGTGGACTCAATTCACC
TCTTCATTTTGCTGCCGCTAAGGGACACAACGAGATTGTTGCATTGTTGC
TTGAGAATGGTGCTGATGTTAATTCTAGAAACTACTGTGGTCAGACGGCA
CTGATGCAGGCATGTCGATATGGTCACTGGGAAGTTGTTCAAACCCTTCT
TCTCTTTAGATGCAATGTTACCAGGGCAGATTATCTTAGTGGAAGAACAG
CTCTCCATTTTGCAGCAGTGAATGGACATGTTAGATGCATAAGACTTGTG
GTGACTGATTTCGTTCCTAGTGCCCCTTTTGAGTCTATAAATGCTCAAAC
AAATGCTGACAGAGGAGACAGTTCAAATTCAAAAGGCAAGCATGAGCAAA
GTCCACTGTCAAAATTTATAAATAAAGCTGCTGATGGTGGTATTACTGCT
CTTCATATGGCTGCATTGAATGGGTATTTTGATTGTGTCCAGCTCCTGCT
TGATCTCAATGCAAATGTTTCAGCTGTGACATTTCACTATGGGTCATCAA
TGGATCTGATA
Genomic location of cSTA-6-E19  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2914 marker 2914
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)