SGN Marker cLEC-9-L9

SGN-M2915

SynonymsNone
Locus associationsNone
Derivations 
This marker was derived from EST clone SGN-C14950
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 40292)
Chromosome
1
Position
40.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
cLEC-9-L9 was used as an overgo probe on plate 8 [well H7]

Plausible BAC Matches:   P109A21

 Overgo Sequences

A sequence
TAATCCAAGGGTGCGTGTGGAATC
B sequence
AGGAGACACCAACAAAGATTCCAC
AB sequence
TAATCCAAGGGTGCGTGTGGAATCTTTGTT
Marker sequence
GAACCGGCCCCACCACCAGTTGTGGAGGGTGGTCCTCCTGGCAGGAAGAT
TGTTGTGTCAACCAACATTGCAGAAACATCTTTGACAATAGATGGCATTG
TTTATGTCATAGATCCAGGATTTGCTAAGCAAAAGGTTTATAATCCAAGG
GTGCGTGTGGAATCTTTGTTGGTGTCTCCTATTTCAAAGGCCAGTGCACA
CCAGAGATCAGGACGTGCTGGAAGAACTCAGCCAGGAAAATGCTTTAGAC
TTTACACGGAGAAAAGTTTCCATAATGACCTTCAACCTCAGACGTATCCA
GAAATACTTCGGTCAAATTTGGCTAATACAGTTCTAACTTTGAAGAAGCT
AGGTATTGAT
Genomic location of cLEC-9-L9  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2915 marker 2915
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)