SGN Marker cTOB-5-D22

SGN-M2916

SynonymsNone
Locus associationsNone
Derivations 
This marker was derived from EST clone SGN-C122697
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 40496)
Chromosome
1
Position
44.50 cM
Confidence
I(LOD2)
Protocol
RFLP
Subscript
A


Tomato-EXPEN 2000

Map: Tomato-EXPEN 2000   
Map version
52 (location: 40497)
Chromosome
7
Position
43.50 cM
Confidence
I
Protocol
RFLP
Subscript
B


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
cTOB-5-D22 was used as an overgo probe on plate 8 [well F10]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
GAATGGGAAGACAGCTATCTGCTC
B sequence
GTTGGATCCAATCCCAGAGCAGAT
AB sequence
GAATGGGAAGACAGCTATCTGCTCTGGGAT
Marker sequence
TGGGGNNNNNAAGGCNNNNGTTTCTGATTCAACGAAAAATGCTGGAGCTC
CACTGCGGTGGCGGCTGCTCTAGAACTAGTGGATCCCCCGGGCTGCAGGA
ATTCGGCACGAGGGAGAGAACTAGTCTCGAGTTTTTTTTGCAAGCCTTAA
GGAAGCACTATCTATTAGCCAATGAAGAGTGGAAGGAAGATATAATGCCT
GAAATTTTAGATGGGCACAATGTCTATGACTTTGTTGACCCTGATATCTT
ACAAAGGCTTGAAGAATTGGAGAGAGAAGAAGGTCTTCGTCAAGAGGAAG
AAGGAGATGATGATTTTGAGATGGACGGTGCAGAGCTGACCCCTGAAGAA
CAAGCAGCATTAGCTGAAATCCGAAAAAAGAAAAGTTTGCTCATTCAGCA
GCATAGAGTGAAGAAGAGCACCGCAGAGAGCAGGCCCACAGTACCAAGAA
AGTTTGATAAAGACAAGGAATTTACTTCAAAAAGAATGGGAAGACAGCTA
TCTGCTCTGGGATTGGATCCAACTCTAGCAATCAATCGAGCTCGAAGTAA
GTCAAGGGGTCGTAAGCGAGAGAGATCAGTTGAATGTGGAGATGACAATG
GTNATGATGCAATGGATGTTGATGAGATTACTCCCAGCAAGAAGCAACGT
AGGTCTAGATCACTTTCCATGGCAAGATCAAGGTCAATGTCACGACCTCG
AAGTGAATTTGGTCCAGGGGGGGGCTTCAGGACCAACCCCCAAAGGAGCC
CGCTATAAAATTGTTTAAAAAACCTGCTAATAAAAGGACCAAGGATGCTC
CTCCGGGGAGAGTCCAATAAAGCCATTCCTACCTTGAAACCCGAAACATC
TCTTTTTTTGGAAGAGAACAAGGGGCAAAACTGACAGGCCGGGTTCCCCA
AAAAAGGCCTTTTTCCCTCCTGCCGGAGAAA

cTOB-5-D22 was used as an overgo probe on plate 9 [well C1]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
GAATGGGAAGACAGCTATCTGCTC
B sequence
GTTGGATCCAATCCCAGAGCAGAT
AB sequence
GAATGGGAAGACAGCTATCTGCTCTGGGAT
Marker sequence
TGGGGNNNNNAAGGCNNNNGTTTCTGATTCAACGAAAAATGCTGGAGCTC
CACTGCGGTGGCGGCTGCTCTAGAACTAGTGGATCCCCCGGGCTGCAGGA
ATTCGGCACGAGGGAGAGAACTAGTCTCGAGTTTTTTTTGCAAGCCTTAA
GGAAGCACTATCTATTAGCCAATGAAGAGTGGAAGGAAGATATAATGCCT
GAAATTTTAGATGGGCACAATGTCTATGACTTTGTTGACCCTGATATCTT
ACAAAGGCTTGAAGAATTGGAGAGAGAAGAAGGTCTTCGTCAAGAGGAAG
AAGGAGATGATGATTTTGAGATGGACGGTGCAGAGCTGACCCCTGAAGAA
CAAGCAGCATTAGCTGAAATCCGAAAAAAGAAAAGTTTGCTCATTCAGCA
GCATAGAGTGAAGAAGAGCACCGCAGAGAGCAGGCCCACAGTACCAAGAA
AGTTTGATAAAGACAAGGAATTTACTTCAAAAAGAATGGGAAGACAGCTA
TCTGCTCTGGGATTGGATCCAACTCTAGCAATCAATCGAGCTCGAAGTAA
GTCAAGGGGTCGTAAGCGAGAGAGATCAGTTGAATGTGGAGATGACAATG
GTNATGATGCAATGGATGTTGATGAGATTACTCCCAGCAAGAAGCAACGT
AGGTCTAGATCACTTTCCATGGCAAGATCAAGGTCAATGTCACGACCTCG
AAGTGAATTTGGTCCAGGGGGGGGCTTCAGGACCAACCCCCAAAGGAGCC
CGCTATAAAATTGTTTAAAAAACCTGCTAATAAAAGGACCAAGGATGCTC
CTCCGGGGAGAGTCCAATAAAGCCATTCCTACCTTGAAACCCGAAACATC
TCTTTTTTTGGAAGAGAACAAGGGGCAAAACTGACAGGCCGGGTTCCCCA
AAAAAGGCCTTTTTCCCTCCTGCCGGAGAAA
Genomic location of cTOB-5-D22  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2916 marker 2916
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)