Notice: The FTP site is available again. We apologize for any inconvenience.

SGN Marker cLET-2-O9

SGN-M2917

SynonymsNone
Locus associationsNone
Derivations 
This marker was derived from EST clone SGN-C84989
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 51098)
Chromosome
1
Position
71.03 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 49034)
Chromosome
1
Position
49.25 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 40380)
Chromosome
1
Position
46.00 cM
Confidence
CF(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
cLET-2-O9 was used as an overgo probe on plate 10 [well F5]

Plausible BAC Matches:   P234J24,   P223M12,   P112A17,   P210F09,   P112C18,   P100M24,   P258E05,   P010N24,   P004L01,   P112A18

 Non-Plausible BAC matches

 Overgo Sequences

A sequence
AGCAGCACCAGATAACAAGCTTTC
B sequence
ATCAGCCACAAGGTCAGAAAGCTT
AB sequence
AGCAGCACCAGATAACAAGCTTTCTGACCT
Marker sequence
AAAATGGCAACCATTGCTGGTGTTAGTCTCACTAGTCCAAAATTCTTGGC
CAAGAATTCCAACTCCCCCAATTTTAAGCCATTTAAGATGCCCTGCCTTA
ACAATCCATGGAAAAAATCATCAACAAAATTTGGTCTTGTGTGTTCAGCA
GCACCAGATAACAAGCTTTCTGACCTTGTGGCTGATAGTGTTAAAGGGGC
AGAGGAAACGTGCAATGAGAACCCGGCTAGCGGAGAATGCGCGGCGGCTT
GGGATGTTGTGGAAGAGGCAAGTGCAGCGGCTAGTCATGCAAGGGACAAG
AAGAAGCACGAAGATGTTTTGGAAAATTATTGCAAGGAAAATCCAGAGAC
TGATGAGTGCCGTACATATGATAATTGATAGTGTACTAGTTTTGTGTTAT
TTAAGCACTCCGCTCTATTTTATTCCCAATTTGAATCTTCAATCCTATGA
ATTACGCTATTCATATGTGTAATGAAAGGATTCTTCCTCTTTCAAATACT
ATACAAACATTTTGAT
Genomic location of cLET-2-O9  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2917 marker 2917
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)