SGN Marker cLET-3-E17

SGN-M2918

SynonymsNone
Locus associationsNone
Derivations 
This marker was derived from EST clone SGN-C85559
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 51099)
Chromosome
1
Position
74.27 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 49035)
Chromosome
1
Position
49.17 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 40382)
Chromosome
1
Position
46.00 cM
Confidence
CF(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
cLET-3-E17 was used as an overgo probe on plate 10 [well C1]

Plausible BAC Matches:   P006E15,   P329B21

 Overgo Sequences

A sequence
CACTCCAGGAAAGCATTAAGAGGC
B sequence
GCAAGGAAGTGCTCATGCCTCTTA
AB sequence
CACTCCAGGAAAGCATTAAGAGGCATGAGC
Marker sequence
CCATCTTAAAGTTATCTTGTGATTTGGGAAAAGAGATGTCAAAACAAGGG
GCTTTTGATCTGGCATTTGGGGTTGGAGGAAGAATTGGCAAGGATGAAGT
TCTCTCTGCTGTTGACAAATATGAGAAGTACCATGGTTATTATGGAGGTG
AAGAAGACGAGAGAAAGAATAACTACACTGACATGGTAAACAAATACTAT
GATCTTTGCACCAGCTTCTATGAATACGGATGGGGAGAGTCCTTCCATTT
TGCGCCCAGATGGAAAGAAGAATCACTCCAGGAAAGCATTAAGAGGCATG
AGCACTTCCTTGCCTTGCAACTGGGATTGAAACCAGGACAAAAGGTCTTG
GATGTAGGATGTGGAATTGGAGGGCCGTTAAGAGAAATTGCTCGATTCAG
CTCTACATCAGTTACAGGCCTCAACAACAATGAATATCAGATATCTCGAG
GACAGGTGTTGAACCGCAAAGTGGGATTGGATCAAACTTGCAACTTTGTA
AAGGGTGATTTCATGAAAATGCCATTCCCTGACAATAGCTTTGATGCAGT
ATATGCAATAGAAGCTACCTGCCATGCACCAGA
Genomic location of cLET-3-E17  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2918 marker 2918
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)