SGN Marker cLEY-14-C14

SGN-M2919

SynonymsNone
Locus associationsNone
Derivations 
This marker was derived from EST clone SGN-C95994
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 51113)
Chromosome
1
Position
72.51 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 49049)
Chromosome
1
Position
49.24 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 40448)
Chromosome
1
Position
46.00 cM
Confidence
CF(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
cLEY-14-C14 was used as an overgo probe on plate 9 [well H3]

Plausible BAC Matches:   P243H06,   P265O23,   P103A12,   P327D03,   P140M14

 Overgo Sequences

A sequence
GATTTTGGGCAGTGTCGAACGTTG
B sequence
CCATTCTGACTCTGGACAACGTTC
AB sequence
GATTTTGGGCAGTGTCGAACGTTGTCCAGA
Marker sequence
GGAGCTGCCAAAGTTGGAAATGTTGAATCTTTGGAGGAATAATTTCACTG
GCTCGATTCCTTCTAAGCTTGGGATGAACGGTAAACTAATTGAAATTGAT
CTGTCTAGTAATAGACTCACTGGCTTGATACCAAAATCTCTATGCTTTGG
GAGGAATTTGAAAATCTTGATTCTTCTTGATAATTTTCTGTTTGGACCTT
TACCTGATGATTTTGGGCAGTGTCGAACGTTGTCCAGAGTCAGAATGGGA
CAGAATTACTTGAGTGGATCAATACCAACAGGGTTTCTTTATTTGCCTGA
GTTGTCACTGGTGGAACTGCAGAACAACTACATCAGTGGACAACTCTGGA
ACGAGAAAAGCTCAGCGTCTTCTAAACTTGAAGGGCTGAACCTGTCGAAC
AATCGCTTGTCTGGTGCACTTCCTAGTGCTATTGGAAACTATTCAGGGCT
GAAGAATCTTGTGTTAACTGGAAATGGTTTCTCAGGTGATATCCCTTCTG
ATATTGGCAG
Genomic location of cLEY-14-C14  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2919 marker 2919
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)