SGN Marker cLPT-4-C16

SGN-M2921

SynonymsNone
Locus associationsNone
Derivations 
This marker was derived from EST clone SGN-C110269
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 40465)
Chromosome
1
Position
51.00 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
cLPT-4-C16 was used as an overgo probe on plate 9 [well C5]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
CACATCGCAAGCTGTTTCCACTAC
B sequence
ATAATGGCAGAGGACGGTAGTGGA
AB sequence
CACATCGCAAGCTGTTTCCACTACCGTCCT
Marker sequence
TTAAAATTGAGCATGAAAAGAAGTTGGCAACCATTACAGAGTCAGGAAAG
CAGAAGTGATGACATAGCCAAGTTGGACAAAACCAAGGCCTCAATAACAA
GGTTGCAGTCACCTGATGGTGGTCACATCGCAAGCTGTTTCCACTACCGT
CCTCTGCCATTATTGGCCTAAGGGACCTCTGACCTTGTCCCGCAGCTTGT
TGAACTTTGTCATGGATTTATGTACATGTGGAAATCCATGAACCAGTTCC
ATCAAGTTCAGAATGACATTGTGCAGCAGGTGCGTGGCCTCATCAACAGA
GAAATTAAAGGTCAATCGACATCTGACCTACACCGGCAGGCAACACGTGA
CCTTGAGTCTGCTGTATCTGCATGGCACTCGAGTTATTGTCGCCTGATAA
AATTTCAAAGGGACTTTATCCGATCCCTTCATGGTTGGTTCAAGCTCACC
CTTGTATCTGTCAATACTGAGCCAACTAATGGCAACAGGGAGTTCTCAGA
TTCATTTATGTTTTGCGATGAGTGGAAGCTAGCACTTGACCGTATTCCTG
ACACTGTTGCATCAGAAGCTATCAAAAGCTTCATAAATGTTGTTCATTCG
ATATATGTGAAACAAACGGAGGAGTTGAAGATCAAAAAGCGAACTGAATC
TGCATCAAAAGAGCTTGAG
Genomic location of cLPT-4-C16  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2921 marker 2921
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)