Notice: The FTP site is available again. We apologize for any inconvenience.

SGN Marker cLEG-37-I19

SGN-M2923

SynonymsNone
Locus associationsNone
Derivations 
This marker was derived from EST clone SGN-C36089
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 40331)
Chromosome
1
Position
61.00 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
cLEG-37-I19 was used as an overgo probe on plate 8 [well D12]

Plausible BAC Matches:   P289N16

 Overgo Sequences

A sequence
TGAAGTCAAAGCACCCAGATGCAG
B sequence
TCAAGTGGAGGAACAGCTGCATCT
AB sequence
TGAAGTCAAAGCACCCAGATGCAGCTGTTC
Marker sequence
CAAGACGCAGCAGATAAATTGGTTCAGATGTTGGATCTTGCACCACCTGG
AAAACAGGAAGTGTTATCACCTGACTTCACACCTAATCCTGTTCTAGAGC
GTTACTACCGCTATCTTAACCTGAAGTCAAAGCACCCAGATGCAGCTGTT
CCTCCACTTGATGAAACCCTCAGAAAGATAACAGAACCTGATGTTGAACT
TCTTTCTCAAAACAAGTCCATCATAGAGGAACTCCGTAGGTCTTTTGAAC
TAAAAGATAATCCAAAGCTGAAAAAATCAGCAAGAAGAATAAAAGAGAGA
CCTTCAGGATCAGATGAGGAGATAGAAGAATTCAACAAAGATGCTGATGT
CAAAGCTATAGACTCCATGGAATACTCAGCCAAAACAGAAGTTGAGAAAG
TTGGAGATGTTAATCCTGTCAAAGACTTTGAGGATATGGCTGTCTCGAAG
AGATAATCCAAAATGGATTAGTAAGGCCATTCAGGATATGAAAAATAGGA
TCTTTGATCTCGTCGAAAATTCTTGTGACGGAGATACATTTCATAAAGCA
TT
Genomic location of cLEG-37-I19  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2923 marker 2923
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)