Notice: The FTP site is available again. We apologize for any inconvenience.

SGN Marker cLET-7-E12

SGN-M2928

SynonymsNone
Locus associationsNone
Derivations 
This marker was derived from EST clone SGN-C88165
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 51095)
Chromosome
1
Position
78.74 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 49031)
Chromosome
1
Position
83.34 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 40412)
Chromosome
1
Position
88.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
cLET-7-E12 was used as an overgo probe on plate 9 [well G3]

Plausible BAC Matches:   P108J06,   P104A05,   P267C18,   P292K19

 Overgo Sequences

A sequence
GGCAGGCTTTTCTTACTCAAAACC
B sequence
GCATTTCCAAAGGTGTGGTTTTGA
AB sequence
GGCAGGCTTTTCTTACTCAAAACCACACCT
Marker sequence
AAGTTAAAGTCAGAACTTCAAGTGCCTGGGTTGAAGTGTGGAGGCACCCT
GCGAGAACGTGCAGGCAGGCTTTTCTTACTCAAAACCACACCTTTGGAAA
TGCTTCCAAAGAAGTTGCTTGCTAACAAGTAATTTTGTGCTCGTCTGTTT
TGCTATAGTAGCTGGTTGTAATTGGAACCTCATGTTCAGCTTATTCTCTG
TTTTACTTGCTATGTAAATATGCGTGTGCATTTTTCAATATATTTCAACA
ACTTCCAAGGACCAACAGTAGTAATTCACTTTTTTAGAGTAATAAAAGGT
GACTAATGTTCATTTGGTTC
Genomic location of cLET-7-E12  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2928 marker 2928
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)