Notice: The FTP site is available again. We apologize for any inconvenience.

SGN Marker cLPT-1-K7

SGN-M2929

SynonymsNone
Locus associationsNone
Derivations 
This marker was derived from EST clone SGN-C109942
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 40459)
Chromosome
1
Position
93.50 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
cLPT-1-K7 was used as an overgo probe on plate 8 [well H6]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

 Overgo Sequences

A sequence
GATTATTGGCCCAGCTATAGGAGG
B sequence
AGGCTGAGCAAAGAAGCCTCCTAT
AB sequence
GATTATTGGCCCAGCTATAGGAGGCTTCTT
Marker sequence
GTCTACATAAAGCGGGTCAAACGGGTTTACCCATTAAGGAGCTCTTCACT
GTATGGGTTGTCATCCTTAGCGCAGCACTTCCAATATCATCTCTCTTTCC
ATTTGTTTATTTCATGATAAGGGACTTTCACATTGCAAAGAGAGAGGAAG
ATATTAGTACATATGCAGGTTATGTAGGTTCTGCATTTATGCTTGGAAGA
GCTTTGACATCTGTCTTATGGGGAACAGTGGCTGATCGATATGGACGAAA
ACCAGTTATAGTTTTTGGCACTTTTGTAGTGGTTATTTTCAATACTCTCT
TTGGTCTTAGTGTTAACTTTTGGATGGCAGTTATTACACGATTTCTTCTC
GGTTTCTTAAATGGTTTGATGGGACCAATAAGGGCATATGCTGCAGAAAT
TTTTCGTGAAGAATATCAAGCAATGGGAATGTCAACGATTAGTAGTGCCT
GNGGTATTGGATTGATTATTGGCCCAGCTATAGGAGGCTTCTTTGCTCAG
CCTGCAGAGAAATATCCGGCTACATTCTCAAAGGATTCTATATTTGGGAG
ATNTCCCTACTTCTTGCCTTGCTTATGCATATCACTGTTTTCCTTTGTCG
TGGGTATTGCTTCAATTTGGCTGCCGGAAACATTACACAATCATGA
Genomic location of cLPT-1-K7  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2929 marker 2929
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)