SGN Marker cLPT-4-B13

SGN-M2930

SynonymsNone
Locus associationsNone
Derivations 
This marker was derived from EST clone SGN-C110253
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 40464)
Chromosome
1
Position
94.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
cLPT-4-B13 was used as an overgo probe on plate 8 [well G5]

Plausible BAC Matches:   P245K12,   P203E06,   P211C13

 Non-Plausible BAC matches

P048N19,   P317A08,   P032H16,   P251K16

 Overgo Sequences

A sequence
CAATATGACCGGAGCTTACAGACG
B sequence
CGGCTTTTGAAACACGCGTCTGTA
AB sequence
CAATATGACCGGAGCTTACAGACGCGTGTT
Marker sequence
GCATCAGTACAGTAAGGGAGTATTACAAGGAAAGTGGTGACATTGATGGG
ACTCTAAGGCAGTTACCTCGTTATCTGGTTGCTGAAAAGGCAATTTTGCA
GTGCCTGAAAAGATCTCCTGGAAACTATCTACAAGCTCTGAAGGCCATAC
CCAGGACTCTCCGAATGATGTATGTTCATAGCTATCAAAGTTATCTTTGG
AACCATGCGGCAAGCATGAGAGTGCAAAAGCATGGGTTTGACCAAGTTGT
GTTGGGAGATTTGGTGTATTCAAAAGAAGAGTATAAAGTGAAAGAATCTT
TTGTTGCTGAATGTGAAGACGTGAATGACAATAATATGGATGATTATAGC
AATCTGGATGAGATCTCAGAGACTGATCTTCCTGAAGAAAGAAATATACC
AGTCAAGTTTATAAATGAAGAAGACCTTAAATCTGGTACATATACCATTG
ATGACGTACTTCTACCTTTGCCTGGGTCTAGAGTTATTTATCCATCAAAT
GACATTGGTGAAGTTTACCGTGACTTGGCACAAAAGGATGGTATCAGCTT
GACAGAGACTGCACATAAGATCAAAGAATTCTCCATAACCAATATGACCG
GAGCTTACAGACGCGTGTTTCAAAAGCCGAAAGATTTTGAATGGGAATTG
CTTA
Genomic location of cLPT-4-B13  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2930 marker 2930
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)