SGN Marker T1963

SGN-M2931
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39810)
Chromosome
1
Position
97.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1963 was used as an overgo probe on plate 8 [well F7]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

 Overgo Sequences

A sequence
GTGTTGCTGCTCTTGTTTTTGGGC
B sequence
TCAGGCAACTGTTTGGGCCCAAAA
AB sequence
GTGTTGCTGCTCTTGTTTTTGGGCCCAAAC
Marker sequence
TCTTGTTCCAATAATCCAACACAATCTTGAACAACAACTGTAGGTCATAT
AACATCAAGAAAATCCAAGATTCAGAAAAAATGGCAGCAATAATCTCATC
TGGTGCTGCTGTTACTACAACTCTTTCTTTATCCTTCACACCAAAACCCA
TTTCATCTTCATCTTCTTCTTCAGCACCCAAGATTCAAACTTTATGTTCT
TCTAGCTCACTTTTCTTCAACAGCAACAGTCAACTGTTTCTGGGTCCTCC
AACAACTACAAGAAAAGTAAGGAGCAACAGCAAAAGGGGTCTTTCTTGTT
ACTGTTTGTTTGGACTTGGAGTCCCAGAGCTGGCGGTGATTGCTGGTGTT
GCTGCTCTTGTTTTTGGGCCCAAACAGTTGCCTGAAGTTGGCCGTAATAT
TGGCAAGACTGTCAAGAGTTTTCAACAGGCTGCAAAAGAGTTTGAAAGTG
AGTTG
Genomic location of T1963  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2931 marker 2931
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)