SGN Marker cLPT-5-M7

SGN-M2933

SynonymsNone
Locus associationsNone
Derivations 
This marker was derived from EST clone SGN-C110663
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 51117)
Chromosome
1
Position
80.80 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 49052)
Chromosome
1
Position
100.21 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 40474)
Chromosome
1
Position
104.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
cLPT-5-M7 was used as an overgo probe on plate 3 [well F3]

Plausible BAC Matches:   P287N03,   P093N02,   P159C14,   P270A21,   P018A19,   P024J16,   P166P03

 Non-Plausible BAC matches

 Overgo Sequences

A sequence
CATACATCACTGCTGGAGATCCTG
B sequence
GCAGTTGTTGCCAGGTCAGGATCT
AB sequence
CATACATCACTGCTGGAGATCCTGACCTGG
Marker sequence
CTCCATTTTCAAGTACTANAAAGTTCGGTGATGGTATGGCATCTTTTCTG
AAAGCAACCCACTTTATTCACTCCAGTAACAACCATCAAAATCATCCATT
TTCTCAGTCCTATACCCAAACAATCAAAATTTCAACTTCTCGCAAACCTC
TAATGGCTGCCCTCAGCGCCACAGCAACAGTTGGACTTTCTGAGACTTTC
ACTCGATTGAAGGAACAAGGCAAGGTGGCACTTATTCCATACATCACTGC
TGGAGATCCTGACCTGGCAACAACTGCAGAAGCACTGAAAGTGCTGGATA
GATGTGGTTCAGATATCATANAAGTAGGAGTACCTTACTCTGATCCATTG
GCTGATGGACCAGTCATCCAGGCTGCTGCTTCACGATCACTGACTAAAGG
AACCAACTTTGCCAAA
Genomic location of cLPT-5-M7  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2933 marker 2933
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)