SGN Marker cLET-4-L11

SGN-M2937

SynonymsNone
Locus associationsNone
Derivations 
This marker was derived from EST clone SGN-C87456
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 40392)
Chromosome
1
Position
145.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
cLET-4-L11 was used as an overgo probe on plate 9 [well B3]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
GGTACTTCATGCACAGCGGAGCTT
B sequence
CAGGTAATGCTCTGTGAAGCTCCG
AB sequence
GGTACTTCATGCACAGCGGAGCTTCACAGA
Marker sequence
GTAGTATTCCATTTGTGGGCTCCTTGCACCCCAAATCACGTCCATCTCCT
TTATTGTCCTTAGGACTTGTTTTGGGTGCATTGCTGATCATTGGTTACGT
ATATCATAGTTCAGGTGGAAGAAGTGCAGCAGATGCTTTTAGTAGACTTG
AAGGTGGTACTTCATGCACAGCGGAGCTTCACAGAGCATTACCTGTACTG
AAGAAAGCATATGGGGATAACATGCGGAAAGTGTTGCACGTAGGCCCTGA
CACTTGTTCAGTGGTCTCTAATCTATTAAAAGAAGAGGATACTGAAGCTT
GGGGCATTGAACCATATGATTTAGAT
Genomic location of cLET-4-L11  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2937 marker 2937
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)