SGN Marker cLET-1-A11

SGN-M2938

SynonymsNone
Locus associationsNone
Derivations 
This marker was derived from EST clone SGN-C82128
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 40363)
Chromosome
1
Position
157.50 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
cLET-1-A11 was used as an overgo probe on plate 8 [well C8]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
TGGGTGATGATTCTGGGAAGCAAC
B sequence
AGATTACGGTGCCTTGGTTGCTTC
AB sequence
TGGGTGATGATTCTGGGAAGCAACCAAGGC
Marker sequence
TGGATTTATGAGTTGTGAGAGAAAGTTCAGATTCAAGCTCAACAGAAAAT
ACATAAGTTTGTACTTGTCTGTATTTTAAGTTGTTTATCTTTTTTGGTCC
TCGTACTCTGCTTTCTGCCACTACATGAATGTTCAAATGGGTGATGATTC
TGGGAAGCAACCAAGGCACCGTAATCTAACCCCGCTGAGGATGATAAGGG
GTATTTTCTGTCTAATTGTGTTAGTACTCTCTGCATTTATGGCGTTAGTG
TATTTTGGCTTTTGGACTGCTACTGGCTTGCGAATTGTCAGTGTCCATTA
TAGCAGAGTGGGAACATCCTTCTTTTTTGGATGTTGGTTAGCTTTGTGGC
CCTTTTGGTTTGAAAAGATTAACAAAACCAAAGTGGTAATGTCTGGAGAT
TCTGTTCCACCTGCCAAACGAGTCTTAGTTATTGCAAACCATCGAACTGA
GGTTGATTGGATGTA
Genomic location of cLET-1-A11  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2938 marker 2938
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)