SGN Marker TG600

SGN-M294

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1100
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
TG600 image not available
Forward sequence
CTGCCATCAATTTGAGTTCTCTGGAATTCTTTGTCGCCATGCTCTCCGTGTTCTTTCAACAGGAAATTGCTTCCAAATACCAGATAGATA
TCTGCCACACCGGTGGCGACGAATCAGTACACCAGCAACAAAAGCTCTTCAGAATACTCAAAGTGATCACACTGAGAGGGTTCAGTTATT
GCAGAGTATGGTTTCTACTCTAGTAACAGAATCAGCAAAGTCAAGGGAACGTCTTGACATTGCAACAGAGAACGTTTCAATCCTTTTATC
GAGGATAAGAGAACAACCAATTAGTTCACTAGGTATTAGAGAGTCATCCTCAAATCAGAGAAATCTCTGATTATAGACAAATAGTTTGAT
CTTGTAGAAAATAGGGACAAAAGAGATGAAAGTGGGGAAACTTGTCTAGCTAGTGTGTAAAGAGTTGGGAGCTGGCTTGATACCCTTTAT
ATGACATATTTGCAGATTATGGTTATACTAAATCTGTGAGAAAAAACATGAAAAAGGCAATATCTTT
Reverse sequence
GGAGACAAGCTTGCATGCCTGCAGATAAAATTAGGGATTCGATTCTTGACCTTTACCTTTAAATAGTATTTGGGGATATTTGATTTCTTT
TTTTTATATATATGTGGAATGTTTTAATCCTCTACTTTATTTTCCCTAAAATTTATGTAGTATACTTTATAATTGAAGATTGATTAATTC
CGCATGAATACTTTTTGTCAATTACTCCATAAATCTCTGTTTATTTATTCATTTTCTCTTTTATAAGGTTCTAATTTTGTTGAAATTTTG
TAATATTTATATTTTCTATCTATCTATTTCCTAATTATTTGTCTATTTTAATTTTAAAAAATTATATATTAAACTCTTAATTAATTACTT
TGAAAAAAAAAAAA
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1725381e-48101 (19.5% of RFLP seq)+
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 40109)
Chromosome
1
Position
128.00 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 2000

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8826)
Chromosome
1
Position
95.60 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
TG600 was used as an overgo probe on plate 14 [well E8]

Plausible BAC Matches:   P147L22,   P243A15

 Overgo Sequences

A sequence
GGAATTCTTTGTCGCCATGCTCTC
B sequence
CTGTTGAAAGAACACGGAGAGCAT
AB sequence
GGAATTCTTTGTCGCCATGCTCTCCGTGTT
Marker sequence
CTGCCATCAATTTGAGTTCTCTGGAATTCTTTGTCGCCATGCTCTCCGTG
TTCTTTCAACAGGAAATTGCTTCCAAATACCAGATAGATATCTGCCACAC
CGGTGGCGACGAATCAGTACACCAGCAACAAAAGCTCTTCAGAATACTCA
AAGTGATCACACTGAGAGGGTTCAGTTATTGCAGAGTATGGTTTCTACTC
TAGTAACAGAATCAGCAAAGTCAAGGGAACGTCTTGACATTGCAACAGAG
AACGTTTCAATCCTTTTATCGAGGATAAGAGAACAACCAATTAGTTCACT
AGGTATTAGAGAGTCATCCTCAAATCAGAGAAATCTCTGATTATAGACAA
ATAGTTTGATCTTGTAGAAAATAGGGACAAAAGAGATGAAAGTGGGGAAA
CTTGTCTAGCTAGTGTGTAAAGAGTTGGGAGCTGGCTTGATACCCTTTAT
ATGACATATTTGCAGATTATGGTTATACTAAATCTGTGAGAAAAAACATG
AAAAAGGCAATATCTTT
Genomic location of TG600  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D294 marker 294
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)