SGN Marker CT190

SGN-M2941

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Tomato-LXCHM 2007   
Map version
68 (location: 42956)
Chromosome
1
Position
65.40 cM
Confidence
uncalculated
Protocol
CAPS


Tomato-LXCHM 2007

PCR data   Exp. ID 43956
Forward primer (5'-3')
TTCAACAACAGGATACTCAATACA
Accessions and product sizes
Approximate temperature
58°C
Reverse primer (5'-3')
TAAGAAGGCAGAGATTTGGC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Eggplant-COSII   
Map version
63 (location: 42316)
Chromosome
1
Position
153.20 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-COSII

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39003)
Chromosome
1
Position
163.50 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000

Map: Tomato-EXHIR 1997   
Map version
32 (location: 12159)
Chromosome
1
Position
179.60 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXHIR 1997

Map: Eggplant-LXM 2002   
Map version
29 (location: 12161)
Chromosome
1
Position
163.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-LXM 2002

Map: Tomato-EXPEN 1992   
Map version
28 (location: 12160)
Chromosome
1
Position
131.70 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992
Genomic location of CT190  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2941 marker 2941
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)