SGN Marker CD29

SGN-M296

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
750
Vector
pUC
Cutting Site
PST1
Drug Resistance
AMP
Image
CD29 image not available
Forward sequence
GGCTGCACTGTTGGCTCATTAATGATCCTAGCAACATTTAATCCAGCAATAACACCAGCATCCTTTGTCGCCTGTCTTTGTGCATCATTG
AAATATGCAGGAACAGTGACCACAGCATCCTTAATAGTCTTCCCAAGGAATGCTTCGGCTGTCTCTTTCATCTTTGTCAAAATCATGGCG
CTGATTTCCTCAGGACTAAATACCTTAACTTCTCCATCCTTGATTTTGACTTGTATGTAGGGCTTTCCATCCTTGCTGACAATCTTGTAC
GGTACCAGCTTCATATCCCTCTGTACTTCCTTATCTTCAAATTTTCTTCCAATCAGCCTCTTAACATCAAAGATTGTTCTTTCTGGGTTG
ACCGCAGCCAGGTTCTTGGCAGCCTCACCAATCAATCTCTCGTTATCAGTGAATGCAACCCATGATGGTGTAATCCTGTTTCCTTGGTCA
TTAGCTATAATCTCCACATGACCATTCTTGTACACCCCAACACAGGAATAGGTTGTCCCAAGATCAATTCCTATAACGGTACCAAGTTTT
GTAGCCTCCTCCTTTGCATTGGAAAGTGCAGAAAGACAGCCTAATAAAACGATCGCTAGCAC
Reverse sequence
not available
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1437846.9e-0767 (11.1% of RFLP seq)+
SGN-U1437824.4e-0885 (14.1% of RFLP seq)+
SGN-U1450904.4e-08113 (18.8% of RFLP seq)+
SGN-U1691037.2e-1076 (12.6% of RFLP seq)+
SGN-U1458624.8e-14111 (18.4% of RFLP seq)+
SGN-U1458635.5e-26155 (25.7% of RFLP seq)+
SGN-U167536505 (83.9% of RFLP seq)+
Mapped locations  
Map: Potato meta-QTL consensus map   
Map version
107 (location: 51702)
Chromosome
8
Position
99.69 cM
Confidence
uncalculated
Protocol
unknown

MQTL_1_Late_blight_8 MQTL_1_Maturity_8 MQTL_2_Late_blight_8
Potato meta-QTL consensus map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38932)
Chromosome
8
Position
87.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8829)
Chromosome
8
Position
91.00 cM
Confidence
I
Protocol
RFLP
Subscript
A


Tomato-EXPEN 1992

Map: Potato-TXB 1992   
Map version
27 (location: 8831)
Chromosome
8
Position
49.20 cM
Confidence
I(LOD2)
Protocol
RFLP


Potato-TXB 1992
Overgo hybridization and physical mapping 
CD29 was used as an overgo probe on plate 11 [well H9]

Plausible BAC Matches:   P036J23,   P291K03,   P104N09,   P096I01

 Overgo Sequences

A sequence
AGGGCTTTCCATCCTTGCTGACAA
B sequence
CTGGTACCGTACAAGATTGTCAGC
AB sequence
AGGGCTTTCCATCCTTGCTGACAATCTTGT
Marker sequence
GGCTGCACTGTTGGCTCATTAATGATCCTAGCAACATTTAATCCAGCAAT
AACACCAGCATCCTTTGTCGCCTGTCTTTGTGCATCATTGAAATATGCAG
GAACAGTGACCACAGCATCCTTAATAGTCTTCCCAAGGAATGCTTCGGCT
GTCTCTTTCATCTTTGTCAAAATCATGGCGCTGATTTCCTCAGGACTAAA
TACCTTAACTTCTCCATCCTTGATTTTGACTTGTATGTAGGGCTTTCCAT
CCTTGCTGACAATCTTGTACGGTACCAGCTTCATATCCCTCTGTACTTCC
TTATCTTCAAATTTTCTTCCAATCAGCCTCTTAACATCAAAGATTGTTCT
TTCTGGGTTGACCGCAGCCAGGTTCTTGGCAGCCTCACCAATCAATCTCT
CGTTATCAGTGAATGCAACCCATGATGGTGTAATCCTGTTTCCTTGGTCA
TTAGCTATAATCTCCACATGACCATTCTTGTACACCCCAACACAGGAATA
GGTTGTCCCAAGATCAATTCCTATAACGGTACCAAGTTTTGTAGCCTCCT
CCTTTGCATTGGAAAGTGCAGAAAGACAGCCTAATAAAACGATCGCTAGC
AC
Genomic location of CD29  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D296 marker 296
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)