SGN Marker cLEX-4-G10

SGN-M2964

SynonymsNone
Locus associationsNone
Derivations 
This marker was derived from EST clone SGN-C94464
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 51110)
Chromosome
11
Position
7.30 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 49046)
Chromosome
11
Position
68.01 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 40443)
Chromosome
11
Position
44.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
cLEX-4-G10 was used as an overgo probe on plate 10 [well C6]

Plausible BAC Matches:   P263O09,   P311P13,   P028L11,   P257K06,   P161E24,   P257K04,   P308C20,   P001G13,   P289C07,   P247P18,   P118I24,   P261C06,   P140E05,   P048N21,   P042D15,   P307I11,   P184A14,   P137J03,   P328H22,   P056A06,   P203J17

 Overgo Sequences

A sequence
TGGTGCTTGTGTTGCTTCGACTTC
B sequence
CGTGCCATCTGCTAAAGAAGTCGA
AB sequence
TGGTGCTTGTGTTGCTTCGACTTCTTTAGC
Marker sequence
GCCTCGTGCCGTTGCAATTGGATAATGCGAAGTTCTTGACTTATCCTCCA
GAATTATCTGAGCAGATTTTTTCTGCTGGTATTTCAGCGTGTAGGTTTAA
CTGTCTTGTTAATGGTGCTTGTGTTGCTTCGACTTCTTTAGCAGATGGCA
CGGGGATGTGTTATATTAAACAGCCAAACTTTGTTAGTGGCTATCAAGCG
CCGACCCTTCCTAGCACTTCATTTCTTAAGATATGTGGGCCTGCAATGCC
TAATCCTACTGCAAATTCAGAACCTGTTCCGGAGAAGAATGGAGGGAGGG
TTCCTGGCTGGGTTGTCGCAGTTGTGGTTGTGGCTAGTGTCTTGGGTTTG
ATCCTGTTGGAGGGTGGTTTGTGGTATTGGTGCTTTAGGAACAGTTCTAA
ATTTGCATCATTGTCATCTCAATATGCACTTCTTGAATATGCCTCTGGTG
CCCCTGTGCAGTTCACATTCAATCAGCTTCAGCGGGCAACCAAGGGGTTT
AAGGAAAAGCTTGGTGCACGAGGATTTGGGGCTGATTATCGGGCCGGTCT
GGCTAATAGGTCTGTTGCTGCAGTGAAACAACTGGAAGGAATTGAGC
Genomic location of cLEX-4-G10  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2964 marker 2964
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)