SGN Marker cLET-10-O11

SGN-M2967

SynonymsNone
Locus associationsNone
Derivations 
This marker was derived from EST clone SGN-C79984
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 51085)
Chromosome
11
Position
50.50 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 49021)
Chromosome
11
Position
91.26 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 40359)
Chromosome
11
Position
74.00 cM
Confidence
CF(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
cLET-10-O11 was used as an overgo probe on plate 3 [well F4]

Plausible BAC Matches:   P176L24

 Overgo Sequences

A sequence
TGCATTGGCTTATGCCGCTCACAA
B sequence
AATAGGTGATGCGGCTTTGTGAGC
AB sequence
TGCATTGGCTTATGCCGCTCACAAAGCCGC
Marker sequence
TATGGCTTCTGCTTTACAAATTTCTTCTCAGTACAGTAAAATTGCTCTTT
GTTCTTTATTTCCTGTTTTTCCAAATTTAAGAAAACCAAACAAGGCACTA
AATTCAGTTACCTCAAATTCCAATAAAAAGTTTAAAATTAGAGCATTGAA
GGAGAAAACAACAGAAGAAGTTAAATCTGCTGAGGAAATTACAAAGAAAT
TTGGTTTAGAAGCTGGCCTATGGAAGATATTTAGCTCAAAAGAGGATAGA
GATGAAGAGAACAAGGATAAGAAATCAAAAGGGGATCAAGCAAAAGAGCT
TTTGGCAAAATATGGAGGAGCTTATTTAGCAACTTCAATTACTCTCTCAT
TGATATCATTTGGTCTCTGTTATGCTCTCATCAATTCTGGTGTTGATGTT
CAATCCTTGCTACAAAAGGTTGGTATTTCTACTGATGAGACTGGTGAGAA
AGTGGGAACTTTTGCATTGGCTTATGCCGCTCACAAAGCCGCATCACCTA
TTAGATTTCCCCCTACTGTTGCTTTAACACCAATTGTTGCTACTTGGATT
GGAAAGAAAGTTGATAAAGAGAAGTAAAACTAGGTTGATTTTGGACACAA
TTTTGCTGCAGATGTAATATATGTGTTAGTAAATACTACAGGTTAATTAT
ATTTACTACTATTTAATTG
Genomic location of cLET-10-O11  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2967 marker 2967
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)