SGN Marker TG602

SGN-M297

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
2100
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
Forward sequence
GTAGAGAGAAAGATAGAACCTATAAATTAAAAATAGGGAAAAAAAAACATAATATACTTCTTCAAGTAATAATTCAACCCATCAATTATC
AAAAAAATGCTTTCCTCCCTTTCTCACACCTCTTCTTCCGCCACCGCTTTCTTCCTCTCTTCCTCCGCCAAATTTCTCCGACCCAGATTC
TCTTCTTGTCCTTTCCAGTTCCCAATTCATCAAAAACGACACCGTTCTCTGTTTTCTCATAGCACAGCAGCTTCAATGGACTCGGCTGCC
ACCGTTGATTCAGTTGCTGATGATTTAAAGAAACAAAACTTAAAAGGAGTTGAAATTAAGCTTAAATTGAATCTCGAAGAGCTTAATTGG
GATAACTCTTTTGTTCGTGAACTACCTGGCGACCCCAGAAGTGATAGTATTCCAAGAGAGGTTTGTGTTCTAATTTCTCAAAGATTGAAT
CTTTATTTGATTGAATGTAAAAGGTGTGTCTTTTTATTGGGGATATTACTCTTTATGGG
Reverse sequence
GGAGACAGCTTGCATGCCTGCAGGGTAGAGAGAAAGATAGAACCTATAAATTAAAAATAGGGAAAAAAAAACATAATATACTTCTTCAAG
TAATAATTCAACCCATCAATTATCAAAAAAATGCTTTCCTCCCTTTCTCACACCTCTTCTTCCACCACCGCTTTCTTCCTCTCTTCCTCC
GCCAAATTTCTCCGACCCAGATTCTCTTCTTGTCCTTTCCAGTTCCCAATTCATCAAAAACGACACCGTTCTCTGTTTTCTCATAGCACA
GCAGCTTCAATGGACTCGGCTGCCACCGTTGATTCAGTTGCTGATGATTTAAAGAAACAAAACTTAAAAGGAGTTGAAATTAAGCTTAAA
TTGAATCTCGAAGAGCTTAATTGGGATAACTCTTTTGTTCGTGAACTACCTGGCGACCCCAGAAGTGATAGTATTCCAAGAGAGGTTTGT
GTTCTAATTTCTCAAAGATTGAATCTTTATTTGATTGAATGTAAAAGGTGTTTCTTTTTATTGGGGATATTACTCTTTATGGGG
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1550792.3e-0686 (16.9% of RFLP seq)+
SGN-U166528325 (63.9% of RFLP seq)+
SGN-U1550792.4e-0686 (16.1% of RFLP seq)-
SGN-U166528325 (60.9% of RFLP seq)-
Mapped locations  
Map: Tomato QTL map   
Map version
137 (location: 53905)
Chromosome
12
Position
86.20 cM
Confidence
uncalculated
Protocol
RFLP

Pentanal_content_pna12_1 Fruit_weight_fw12_1 Titratable_acidity_ta12_1 Fruit_diameter_fd12_1 pH_pH12_1
Tomato QTL map

Map: Potato meta-QTL consensus map   
Map version
107 (location: 53364)
Chromosome
12
Position
54.92 cM
Confidence
uncalculated
Protocol
unknown

MQTL_2_Late_blight_12 MQTL_1_Late_blight_12
Potato meta-QTL consensus map

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8833)
Chromosome
12
Position
91.80 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992

Map: Potato-TXB 1992   
Map version
27 (location: 8832)
Chromosome
12
Position
62.80 cM
Confidence
I(LOD2)
Protocol
RFLP


Potato-TXB 1992
Overgo hybridization and physical mapping 
TG602 was used as an overgo probe on plate 15 [well H10]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

P162K07,   P163C05,   P004A15,   P108M03,   P163B13,   P009O22,   P193B22,   P143F04,   P292L02,   P254J11,   P054I08,   P273F16,   P286F09,   P035A11,   P288E16,   P016F23,   P193D22,   P030J22,   P165K19,   P035H23,   P184B11,   P172E03,   P165B19

 Overgo Sequences

A sequence
TCTTCCTCTCTTCCTCCGCCAAAT
B sequence
AATCTGGGTCGGAGAAATTTGGCG
AB sequence
TCTTCCTCTCTTCCTCCGCCAAATTTCTCC
Marker sequence
GTAGAGAGAAAGATAGAACCTATAAATTAAAAATAGGGAAAAAAAAACAT
AATATACTTCTTCAAGTAATAATTCAACCCATCAATTATCAAAAAAATGC
TTTCCTCCCTTTCTCACACCTCTTCTTCCGCCACCGCTTTCTTCCTCTCT
TCCTCCGCCAAATTTCTCCGACCCAGATTCTCTTCTTGTCCTTTCCAGTT
CCCAATTCATCAAAAACGACACCGTTCTCTGTTTTCTCATAGCACAGCAG
CTTCAATGGACTCGGCTGCCACCGTTGATTCAGTTGCTGATGATTTAAAG
AAACAAAACTTAAAAGGAGTTGAAATTAAGCTTAAATTGAATCTCGAAGA
GCTTAATTGGGATAACTCTTTTGTTCGTGAACTACCTGGCGACCCCAGAA
GTGATAGTATTCCAAGAGAGGTTTGTGTTCTAATTTCTCAAAGATTGAAT
CTTTATTTGATTGAATGTAAAAGGTGTGTCTTTTTATTGGGGATATTACT
CTTTATGGG
Genomic location of TG602  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D297 marker 297
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)