SGN Marker T1948

SGN-M2972
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39799)
Chromosome
11
Position
91.00 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1948 was used as an overgo probe on plate 10 [well A11]

Plausible BAC Matches:   P164K14

 Overgo Sequences

A sequence
TCAAGGGAGATCCAGTTCCTTGTG
B sequence
TTCCCAGCACACCTATCACAAGGA
AB sequence
TCAAGGGAGATCCAGTTCCTTGTGATAGGT
Marker sequence
AACCTTTGTTGGAAAAGAAGGACATCAAGTAAAAGGGCATGTTTTTCCCA
ATTTCACCAATTTTTCCCTTTCCCCACAAATCATCATCATCCCATTTTGC
TCTTTGTTGGTTTTGATTCTCCCCCTTTGGATACTCAAACTTTTCTTGCC
ACTATCAGTGTTTTAACTGCCATTGCTCTCTCCCTCTTTCTTGGCCTCAA
GGGAGATCCAGTTCCTTGTGATAGGTGTGCTGGGAATGGTGGGACAAAGT
GCGTGTTTTGCAACGATGGTAAGATGAAGAAAGAAACAGGATTAGTAGAC
TGCAAAGTTTGCAAGGGTGCACGATTAATACTCTGCAAGAAATGTGCTGG
TTCTGGATACTCAAAAAGGCTATAACATATACTACTTGTACTCTTTTTTC
CTCTAGCTATTGACTTGCGTTCTGAGGCTAAATCACACATACAAGCTCAC
ATATGAGGCTATCTCATTTTGGTTAAATT
Genomic location of T1948  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2972 marker 2972
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)