SGN Marker cLPT-6-E9

SGN-M2975

SynonymsNone
Locus associationsNone
Derivations 
This marker was derived from EST clone SGN-C110808
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 51118)
Chromosome
12
Position
0.56 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 49053)
Chromosome
12
Position
12.17 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 40476)
Chromosome
12
Position
14.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
cLPT-6-E9 was used as an overgo probe on plate 3 [well D10]

Plausible BAC Matches:   P136L18,   P025K20,   P280I04,   P004J14,   P172A11

 Non-Plausible BAC matches

P239O15,   P143H09,   P026C13,   P271P13,   P265L16,   P052A03,   P291N15,   P004H22

 Overgo Sequences

A sequence
GGTTAGGGAGAAAGTTAGGGAACA
B sequence
CCACCAAACTTTCCCTTGTTCCCT
AB sequence
GGTTAGGGAGAAAGTTAGGGAACAAGGGAA
Marker sequence
GGATGCCCATTTGTTAAAAAAAGCTCAGTTTTTGCTATTTAATGGTAAAA
ATTTGGCCTTTCTTTGAATTATTGGATATCCCATGTGTAAAAAAGCTCAA
TTTTTGCAATTTAATGCTAAAAATTTGACCTTTCTTTGAATTCTTGGATA
CCTATATGTAAAAAGATTCAATTTTTATACTTTTATGTTAAAGTTGAGAG
CTTGTTTTGTGTGAAATCCAAAAAATGTATGGAACCCATAGCAAGAGAGA
CATGGAGATTGAATATCAATCTCAAGTTCCAATTTTGAGGCCAAGTATAC
ATGCCAGAAGGGCAAAGATTACTGTGAAATTTCAAGATCTGTATGGATTT
ACTGTTGAAGGGAATGTTGATGATGTTAATGTGTTGAATGAGGTTAGGGA
GAAAGTTAGGGAACAAGGGAAAGTTTGGTGGTCATTAGAAGCTAGCAAAG
GTGCTAATTGGTATTTGCAAACTCATGTTTCCTCAACCCTTAAAACATCC
CTCAAATTCTCTGCTTTGGTGAATGCAATTACTCTCAAGAAGCTCATTAG
GAAAGGAATTCCACCTGTTTTGAGGCCTAAGGTGTGGTTTTCACTATCAA
GAGCTGCTAAGAAGAAATCGACTGCCCCGGATAGTTATTATGAGGATTTG
ACA
Genomic location of cLPT-6-E9  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2975 marker 2975
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)