SGN Marker cLET-8-K4

SGN-M2979

SynonymsNone
Locus associationsNone
Derivations 
This marker was derived from EST clone SGN-C88568
Mapped locations  
Map: Eggplant-COSII   
Map version
63 (location: 42506)
Chromosome
12
Position
35.90 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-COSII

Map: Tomato-EXPEN 2000   
Map version
52 (location: 40424)
Chromosome
12
Position
41.00 cM
Confidence
F(LOD3)
Protocol
CAPS


Tomato-EXPEN 2000

Map: Eggplant-LXM 2002   
Map version
29 (location: 12295)
Chromosome
12
Position
37.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-LXM 2002
Other PCR data 
PCR data   Exp. ID 14067
Forward primer (5'-3')
CACTTTGTGGCAATCGACAT
Digested band sizes (using DpnII)
Solanum pennellii LA716: 900
Solanum lycopersicum LA925: 1000
Mg+2 concentration
Unknown
Reverse primer (5'-3')
TGCCTTATGCCAAACAGAAA
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1100
Solanum lycopersicum LA925: 1100
Approximate temperature
55°C
  
PCR data   Exp. ID 14067
Forward primer (5'-3')
CACTTTGTGGCAATCGACAT
Digested band sizes (using DpnII)
Solanum lycopersicum LA925: 1000
Solanum pennellii LA716: 900
Mg+2 concentration
Unknown
Reverse primer (5'-3')
TGCCTTATGCCAAACAGAAA
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1100
Solanum pennellii LA716: 1100
Approximate temperature
55°C
  
PCR data   Exp. ID 14154
Forward primer (5'-3')
CACTTTGTGGCAATCGACAT
Digested band sizes (using TaqI)
Solanum lycopersicum LA925: 350+500
Solanum pimpinellifolium LA1589: 500+800
Mg+2 concentration
Unknown
Reverse primer (5'-3')
TGCCTTATGCCAAACAGAAA
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 1200
Solanum lycopersicum LA925: 1200
Approximate temperature
55°C
  
PCR data   Exp. ID 149
Forward primer (5'-3')
Unknown
Digested band sizes (using DpnII)
Solanum pennellii LA716: 900
Solanum lycopersicum LA925: 1000
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
Unknown
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1100
Solanum lycopersicum LA925: 1100
Approximate temperature
55°C
  
Overgo hybridization and physical mapping 
cLET-8-K4 was used as an overgo probe on plate 4 [well D6]

Plausible BAC Matches:   P336A13,   P192D17,   P161B22,   P222K23,   P102I04,   P161C09,   P215L09,   P159O09,   P270M14,   P100H03,   P123B16,   P196A15,   P180E20,   P189E07,   P262D22,   P104N14,   P116A07,   P248C03,   P217E12,   P180O10,   P292B18,   P161E19

 Overgo Sequences

A sequence
GGAAAGGATCTCGTTCTGTCTGTG
B sequence
CACCCATTGCAGACATCACAGACA
AB sequence
GGAAAGGATCTCGTTCTGTCTGTGATGTCT
Marker sequence
GCAAAATGTCACTTTGTGGCAATCGACATTTTCAATGCAAAAAAGCTTGA
AGATATTGTTCCTTCATCCCACAATTGTGATGTGCCACATGTCAATCGTA
CTGACTATCAGCTGATTGACATATCTGAAGATGGTTTTGTGTCTCTTCTT
ACTGAAAATGGAAACACCAAAGACGACCTCAGACTTCCCACCGATGACAC
CCTGTTGAACCAGGTTAAAGGTGGATTTGAGGAAGGAAAGGATCTCGTTC
TGTCTGTGATGTCTGCAATGGGTGAAGAGCAGATCTGTGCTGTGAAGGAC
ATTGGTACCAAGACCTAGTTGTGTGCATTCTGCAGCATAAATAATTGCTT
TTTAGCGAAGACGTTTTATATCTTGTTATCGTGGTACCTTTGCAATCTGT
TTTATCGTGAAAACACCTTATATCTATTGGCATGGCTTGAATAGTTGAAA
CTCTAATAGTTTCTGTTTGGCATAAGGCAATGAACTGGATTTGATAGCAG
AAATAATCTACATGTCACTTTTTTTTT
Genomic location of cLET-8-K4  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2979 marker 2979
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)