Notice: The FTP site is available again. We apologize for any inconvenience.

SGN Marker cLET-5-M3

SGN-M2981

SynonymsNone
Locus associationsNone
Derivations 
This marker was derived from EST clone SGN-C87780
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 40403)
Chromosome
7
Position
94.00 cM
Confidence
I
Protocol
RFLP
Subscript
A


Tomato-EXPEN 2000

Map: Tomato-EXPEN 2000   
Map version
52 (location: 40404)
Chromosome
12
Position
57.00 cM
Confidence
F(LOD3)
Protocol
RFLP
Subscript
B


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
cLET-5-M3 was used as an overgo probe on plate 5 [well F7]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

P199I24,   P289H06,   P223O09,   P024A16,   P301E10,   P301L17,   P334I13

 Overgo Sequences

A sequence
GCTTGCCCTTGGTAAAAGGGATAG
B sequence
AGAGAGAATGGCTGACCTATCCCT
AB sequence
GCTTGCCCTTGGTAAAAGGGATAGGTCAGC
Marker sequence
GTAAAATTCATCTTTACCAATATAAATGCGAATAATCCAGATGATGAGTA
CTCTTTTACTGTTCGTCGTGAGAATGATGCACATACTTTGATTGATTGTG
ATCCACAGCTGAATGACGCAAAAGAACTGATTATTGAGTTAAATAAAAGC
AATGGAATGTTCAAGTTTGTCAGGACTATGAGAAAGAAGTTTCTAGAAGC
TGTAGCACGTGGATTAACATCGCAAGATCAAGATACTTCAATGGTCTCTA
TGCCTACGGTGATGTCGTCCATCTCAATTATTAGTAGAGATGAATCTTCA
CCCCAGAAAGCGGAGCCTCAGTCTGATGAATATAAGAGAGCTTNCAGGAA
GCTTGCCCTTGGTAAAAGGGATAGGTCAGCCATTCTCTCTCCTGTATCTG
CATTATCTCTTCGCAGATCTCCTCGTTTTAAGGTCAATAAATGATAATTA
TCAGCACTTC

cLET-5-M3 was used as an overgo probe on plate 7 [well G4]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
GCTTGCCCTTGGTAAAAGGGATAG
B sequence
AGAGAGAATGGCTGACCTATCCCT
AB sequence
GCTTGCCCTTGGTAAAAGGGATAGGTCAGC
Marker sequence
GTAAAATTCATCTTTACCAATATAAATGCGAATAATCCAGATGATGAGTA
CTCTTTTACTGTTCGTCGTGAGAATGATGCACATACTTTGATTGATTGTG
ATCCACAGCTGAATGACGCAAAAGAACTGATTATTGAGTTAAATAAAAGC
AATGGAATGTTCAAGTTTGTCAGGACTATGAGAAAGAAGTTTCTAGAAGC
TGTAGCACGTGGATTAACATCGCAAGATCAAGATACTTCAATGGTCTCTA
TGCCTACGGTGATGTCGTCCATCTCAATTATTAGTAGAGATGAATCTTCA
CCCCAGAAAGCGGAGCCTCAGTCTGATGAATATAAGAGAGCTTNCAGGAA
GCTTGCCCTTGGTAAAAGGGATAGGTCAGCCATTCTCTCTCCTGTATCTG
CATTATCTCTTCGCAGATCTCCTCGTTTTAAGGTCAATAAATGATAATTA
TCAGCACTTC
Genomic location of cLET-5-M3  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2981 marker 2981
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)