SGN Marker cLET-8-E15

SGN-M2983

SynonymsNone
Locus associationsNone
Derivations 
This marker was derived from EST clone SGN-C88448
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 40418)
Chromosome
12
Position
57.70 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
cLET-8-E15 was used as an overgo probe on plate 14 [well B4]

Plausible BAC Matches:   P085H13,   P019B03,   P312K17,   P062P09,   P260K13,   P193G09

 Non-Plausible BAC matches

 Overgo Sequences

A sequence
GAGAAAGATCTGCAGCGAAGATGG
B sequence
ACACTTCTTGCTGCCTCCATCTTC
AB sequence
GAGAAAGATCTGCAGCGAAGATGGAGGCAG
Marker sequence
TGCTGGAGAGTGGAGAAAGATCTGCAGCGAAGATGGAGGCAGCAAGAAGT
GTGAAAGATGTTTCCCCCCATGATTTTGTCAAGGCTTATGCCGCTCATCT
CAAGCGCTCCGGAAAGATGGAGCTTCCTGAATGGACTGATATAGTTAAGA
CTGGTAAGCTAAAGGAGCTTGCCCCATATGATGCTGATTGGTACTACATC
AGAGCTGCTTCCATGGCAAGGAAGATCTATTTGAGAGGAGGTATTGGTGT
TGGTGGTTTCCGAAGAATCTATGGTGGAAACCAGAGGAATGGAAGCCGTC
CACGTCACTTTTGCAAGAGCAGTGGTTCAGTTGCACGCCACATTCTTCAA
CAGTTGCAGAACATGAACATCATTGACTTTGAGCCTAAGGGCGGAAGGAG
GATCACATCCAGTGGTCAGCGGGATCTTGACCAAGTTGCCGGAAGAATTG
CTGTTGCTTGTTAAGAGAGAGATGAGTTTATTCCATTTTATGAATACATG
AGTTAGCTCAAACTTATTGGTTCTGTTTGGACCTAAATAGATTTAGGGTA
TTG
Genomic location of cLET-8-E15  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2983 marker 2983
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)