SGN Marker cLPT-1-F6

SGN-M2987

SynonymsNone
Locus associationsNone
Derivations 
This marker was derived from EST clone SGN-C109873
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 51115)
Chromosome
12
Position
45.44 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 49051)
Chromosome
12
Position
60.37 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 40455)
Chromosome
12
Position
60.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
cLPT-1-F6 was used as an overgo probe on plate 15 [well B2]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
ATGAACTCCACAGTGCAGTGCTTG
B sequence
GTTCCGGAACTGAATGCAAGCACT
AB sequence
ATGAACTCCACAGTGCAGTGCTTGCATTCA
Marker sequence
GGATGATGGGAACTGCTGATGAAATTGTGAAGGCCCCTGAGAAGGGTCCT
ATTTTTGTTGAAGATATGCCTGAAGAAGAGCAAGTGGTTAATGTAGGTCA
TTCAGCTGGATTATTTAATCTTGGAAACACATGCTACATGAACTCCACAG
TGCAGTGCTTGCATTCAGTTCCGGAACTGAAGTCTTCTCTGACTGAGTAT
AATCAACTGGGTAAAAGCAATGATTTGGATCACTCATCTCATCTCTTGAC
AGTTGCAACAAGAGATCTATTTAATGACCTTGATAAAAATGTGAAGCCAG
TGGCACCAATGCAGTTCTGGATGGTTTTGCGGAAGAAATATCCTCAATTT
GGCCAGCAGAGCAATGGAGCTTTCATGCAACAGGATGCCGAAGAATGTTG
GACCCAACTACTTTACACCCTTTCCCAGTCTCTTAAATCACCGAATTCGA
GTGAAGGTCAGGATATTGTGAAGACTCTCTTCGGTATTGACTTTGATAAC
AGGATCCATTGTGCTGAAAGTGGTGAAGAAAGCACAGAAACAGAAACTGT
CTATTCCCTTAAATGCCACATTTCGCAGGAAGTTAACCATTTGCACGAGG
GTTTGAAACGTGGTCTG
Genomic location of cLPT-1-F6  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2987 marker 2987
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)