SGN Marker cLET-5-A5

SGN-M2999

SynonymsNone
Locus associationsNone
Derivations 
This marker was derived from EST clone SGN-C87538
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 40395)
Chromosome
2
Position
31.00 cM
Confidence
CF(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
cLET-5-A5 was used as an overgo probe on plate 10 [well D11]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
ATTCCCAATTGCCGCAAACCTCCT
B sequence
AGACTGGAAATCGGAGAGGAGGTT
AB sequence
ATTCCCAATTGCCGCAAACCTCCTCTCCGA
Marker sequence
GTGGAAGAGAGCAAAGATGAGAGGGATTCTCCGGCGGTTGATCGGCGGCA
GACAGCCATTCACATCATCACGGCGTTCTTCTGAATTAGGTCAAACATTA
ATGGTGTCATCAGCAGCTACAGTCTCTTACTCCACTGTAACTTTCATGGA
GAAACCTAATCTACTTTATGGATTCCCAATTGCCGCAAACCTCCTCTCCG
ATTTCCAGTCTCTTCACGTTCTCAATCAATATCGAAACTTCTCCAGTCCA
TCTTTCTCAGGTCCATCAAATATTGTATCAATTGAGTCTGAAGACAATTC
AATACTTCACTTCGCA
Genomic location of cLET-5-A5  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2999 marker 2999
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)