SGN Marker TG294

SGN-M30

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1400
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
Forward sequence
ACTATAAGAGGCTCGTTGAGCTTGCAAAGAAACAAGTGGACTACATATTAGGAGATAATCCAGCAAAAATATCGTACATGGTTGGTTTTG
GAGACAAGTATCCACTTCGCGTGCACCATAGAGGTTCATCTCTACCATCAGTGCATGCACATCCTGGTCACATTGGCTGCAATGATGGAT
TCCAGTCTTTGAATTCGGGGTCGCCGAATCCAAACGTTCTCATTGGAGCCATCGTGGGTGGTCCTGATAGTAGAGATAACTTTGAAGATG
ACAGGAACAATTATCAGCAATCGGAGCCTGCTACATACATTAATGCTCCACTAGTTGGGGCCCTTGCTTTCTTATCCGCACCAAATTAAA
GTAGTAGTGGATGGAGTCACATAATTTATTAACTAAAGTAAGTGTTGTAGCAGAAGATGAGGATCAAGAAATCAGTATGGTCCCGTGGTA
GCTCAACATAATTGTAAAATGAAGGTTACACATTTAGGTCCTTCTATGCATGTAAGCAAGAGGAATTCCTTGGTGGTTTCCTAGGAATGT
TAAGACCCTTGGTATGAATTTCCAGACTTATTATTCACATATTCCAAATTGAATACTCAGCCAGCAATTACAATGAATTTCTTGTAGAAT
CATAAATCAGTAAGTAACTAAGAGGCAACACTCGAAAAATGAAACATTTATC
Reverse sequence
TAGCAACAATTGGTGCCTAATTAGATTGAAGAAAAATGAGTGATTATGTCTTTTCTTCCTATACTAAAGTATTAAGTAATTATAACCCAA
AAATGTACCTAGATATGATATCTATGATCAAATGTTAACAGAATGAAGTGGACAAAAATGAACAAGGCTATAAATAACAAAGAAGATTGG
GCACACTCACTTTGTAACATCCATTGAGAACTCTCTACTGTAAGGGATTAGGATATGTTCCCTAAAGCAATTCATTGTTCATCTCCACAA
AAGTAGTAGTGTTACAACAAAATAAGAGGTCAATTTTCATATTTTAATGTGTAACACTGACATAATTCTAAGCAGGACGGCCATCTACAT
TACATTTGAAGCTATGTGTAATAGACTTCCATCAGTGCTTATAAATATGAAAGCGATAGTTAAACAACAACTATCAAGTGATTCTCAAAT
CATCAATCATTATCCATTGAGTTTATCATGGTCATCTTCCAGTGGTATTGAAAACTTTGGTGTTGATTTAACAGTTAAACTAATTGAAAC
AAGGATAAGATTTAAGTTCTGTTCATGTGCTCAAGAAAAATAGAGTTACATGTCGTACAGGAACAAGTCCTATGAGTTGAATTGAACAAG
AAAATAATCCAAATTCAACTTTGATAGTTGGCAACTTAAAGCATG
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1717193e-102187 (27.4% of RFLP seq)+
Mapped locations  
Map: Tomato-EXPIMP 2009   
Map version
126 (location: 53533)
Chromosome
8
Position
80.56 cM
Confidence
uncalculated
Protocol
RFLP


Tomato-EXPIMP 2009

Map: Potato meta-QTL consensus map   
Map version
107 (location: 53256)
Chromosome
8
Position
102.04 cM
Confidence
uncalculated
Protocol
unknown

MQTL_1_Late_blight_8 MQTL_1_Maturity_8 MQTL_2_Late_blight_8
Potato meta-QTL consensus map

Map: Pepper-COSII   
Map version
58 (location: 41630)
Chromosome
1
Position
16.80 cM
Confidence
I(LOD2)
Protocol
RFLP


Pepper-COSII

Map: Tomato-EXPIMP 2008   
Map version
55 (location: 40855)
Chromosome
8
Position
88.00 cM
Confidence
uncalculated
Protocol
CAPS


Tomato-EXPIMP 2008

PCR data   Exp. ID 36577
Forward primer (5'-3')
GTTCTCATTGGAGCCATCGT
Accessions and product sizes
Approximate temperature
Unknown
Reverse primer (5'-3')
GATTGGGCACACTCACTTT
Digested band sizes (using AluI)
Solanum pennellii TA56
800
Solanum lycopersicum TA209
550
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39982)
Chromosome
8
Position
87.00 cM
Confidence
I(LOD2)
Protocol
CAPS


Tomato-EXPEN 2000

Map: Tomato-EXPEN 1992   
Map version
28 (location: 7803)
Chromosome
8
Position
92.20 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992
Other PCR data 
PCR data   Exp. ID 35628
Forward primer (5'-3')
ATTGGCTGCAATGATGGATT
Digested band sizes (using AluI)
Solanum pennellii LA716: 900
Solanum lycopersicum LA925: 800
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
CTAAGCAGGACGGCCATCTA
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 900
Solanum pennellii LA716: 900
Approximate temperature
50°C
  
PCR data   Exp. ID 106
Forward primer (5'-3')
Unknown
Digested band sizes (using AluI)
Solanum pennellii LA716: 900
Solanum lycopersicum LA925: 800
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
Unknown
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 800
Solanum pennellii LA716: 900
Approximate temperature
50°C
  
Overgo hybridization and physical mapping 
TG294 was used as an overgo probe on plate 11 [well G11]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
GAGGTTCATCTCTACCATCAGTGC
B sequence
TGACCAGGATGTGCATGCACTGAT
AB sequence
GAGGTTCATCTCTACCATCAGTGCATGCAC
Marker sequence
ACTATAAGAGGCTCGTTGAGCTTGCAAAGAAACAAGTGGACTACATATTA
GGAGATAATCCAGCAAAAATATCGTACATGGTTGGTTTTGGAGACAAGTA
TCCACTTCGCGTGCACCATAGAGGTTCATCTCTACCATCAGTGCATGCAC
ATCCTGGTCACATTGGCTGCAATGATGGATTCCAGTCTTTGAATTCGGGG
TCGCCGAATCCAAACGTTCTCATTGGAGCCATCGTGGGTGGTCCTGATAG
TAGAGATAACTTTGAAGATGACAGGAACAATTATCAGCAATCGGAGCCTG
CTACATACATTAATGCTCCACTAGTTGGGGCCCTTGCTTTCTTATCCGCA
CCAAATTAAAGTAGTAGTGGATGGAGTCACATAATTTATTAACTAAAGTA
AGTGTTGTAGCAGAAGATGAGGATCAAGAAATCAGTATGGTCCCGTGGTA
GCTCAACATAATTGTAAAATGAAGGTTACACATTTAGGTCCTTCTATGCA
TGTAAGCAAGAGGAATTCCTTGGTGGTTTCCTAGGAATGTTAAGACCCTT
GGTATGAATTTCCAGACTTATTATTCACATATTCCAAATTGAATACTCAG
CCAGCAATTACAATGAATTTCTTGTAGAATCATAAATCAGTAAGTAACTA
AGAGGCAACACTCGAAAAATGAAACATTTATC
Genomic location of TG294  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D30 marker 30
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)