SGN Marker cLEC-27-M9

SGN-M3002

SynonymsNone
Locus associationsNone
Derivations 
This marker was derived from EST clone SGN-C4561
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 51068)
Chromosome
2
Position
35.33 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 49004)
Chromosome
2
Position
53.77 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 40277)
Chromosome
2
Position
46.00 cM
Confidence
CF(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
cLEC-27-M9 was used as an overgo probe on plate 10 [well E11]

Plausible BAC Matches:   P327M11,   P161B09,   P066C13,   P189B20,   P009A18,   P032A18,   P327F11,   P298F16,   P190J17,   P062O08,   P226H18,   P276F11,   P009H07,   P055F13,   P168N18,   P327E11

 Non-Plausible BAC matches

 Overgo Sequences

A sequence
TTACTGGGAGATGCTGTTTGTGGC
B sequence
TTCTCGCAGTAGCCATGCCACAAA
AB sequence
TTACTGGGAGATGCTGTTTGTGGCATGGCT
Marker sequence
ACCAACTGAAGCACAAGTTAAAGATATTGCACAGTGGTTACTAGTTGCTC
ATAAGGACTCTACAGGTTTAAGTACCGACTGCCTTGCGGATGCTGGTTAT
CCTGGTGCGGCTTTACTGGGAGATGCTGTTTGTGGCATGGCTACTGCGAG
AATTACTTCCAAGGATTTTCTATTCTGGTTCAGGTCTCACACAGCTAAGG
AAGTCAAGTGGGGAGGTGCTAAGCATCATCCAGATGATAAAGATGATGGA
GGAAAAATGCACCCACGATCTTCATTTAATGCCTTTCTTGAAGTGGTTAA
AAGCAGAAGTTTGCCATGGGAGATTCCGGAGATTAATGCCATTCATTCTC
TACAAATCATAATGAGAGAATCAATCCAAGAGAACGAAAACAGCTCTCTA
AAAACTTTGACTACTTCTCAACAGAATGATGCTGATGGGCCAAGCATGGA
TGAGCTTAGTTCTGTGGCAATGGAAATGGTTAGATTGATTGAGACAGCCA
CTGCTCCAATTTTCGGAGTTGATCCATCTGGCTTAATAAATGGATGGAAA
TGAGAAGATTGCTGACTTAACAAGATTGCATGCTA
Genomic location of cLEC-27-M9  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D3002 marker 3002
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)