SGN Marker cLPT-1-E8

SGN-M3003

SynonymsNone
Locus associationsNone
Derivations 
This marker was derived from EST clone SGN-C109861
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 51119)
Chromosome
2
Position
35.66 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 49054)
Chromosome
2
Position
51.82 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 40454)
Chromosome
2
Position
47.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
cLPT-1-E8 was used as an overgo probe on plate 12 [well B2]

Plausible BAC Matches:   P002C08,   P141O14,   P233P14

 Overgo Sequences

A sequence
ATTATGCCTCTGGTGCAGCTGGAA
B sequence
CCTGACTCGTCACGAATTCCAGCT
AB sequence
ATTATGCCTCTGGTGCAGCTGGAATTCGTG
Marker sequence
GAAAATATGGTTTGTGTTGTTAACCACTATATTTGTGATCAATTTTAGGC
CATTTTTAGTAATGGTAAAGGGTGAACCACAAGTGCCTTGTTTGTTTATT
TTTGGTGATTCTTTATTTGATAATGGAAATAACAATAATCTCATCACTAC
TGCAAAGGCTAATTATTCACCTTATGGAATTGATTTTCCTGATGGCCCTA
CTGGTAGATTCACCAATGGAAAAAACTCAGCAGATTTTCTTGCTGAATTA
TTGGGTTTTGATAAGTTTATTGAGCCATTTGCCACAGTGAAGGGTGTGGA
TATATTTAGAGGTGTAAATTATGCCTCTGGTGCAGCTGGAATTCGTGACG
AGTCAGGAATACATTTGGGAGATAGAATCAGCTTGAACAGGCAATTGAGA
AATCACAAGGTGACAATTTCCCACATGTCTATTCTACTTGGAAATAAAAC
CTTAACTATGGATTATCTAAGCAAATGTATATACATTGTTGGAATGGGCA
ACAATGACTACATCAATAACTACTTGATGCCTCAATTTTACCCATCAAGT
CATTTATACAATCCAGAAAAATTTGCCACTATCCTAATGCAACAATATTC
AAAACAATTGAAGACATTGTATCGTTACGGAGCAAGAAAA
Genomic location of cLPT-1-E8  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D3003 marker 3003
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)