SGN Marker cLEX-4-I9

SGN-M3007

SynonymsNone
Locus associationsNone
Derivations 
This marker was derived from EST clone SGN-C94521
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 51111)
Chromosome
2
Position
39.40 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 49047)
Chromosome
2
Position
81.93 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 40444)
Chromosome
2
Position
72.00 cM
Confidence
CF(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
cLEX-4-I9 was used as an overgo probe on plate 11 [well E2]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
AAGTGCACCAGCTGTACCAAGTAC
B sequence
CCACTCCAACAACTCAGTACTTGG
AB sequence
AAGTGCACCAGCTGTACCAAGTACTGAGTT
Marker sequence
GACTGATCTCACTCTCTCTCAATCTGAACATGGCGGAAGCAAGTGCACCA
GCTGTACCAAGTACTGAGTTGTTGGAGTGGCCAAAGAAAGATAAGCGCAG
AATGTTGCATGCTGTATATCGTGTCGGTGACCTTGAACGTACCATCAAGT
TTTACACAGAATGTTTTGGGATGAAATTGTTGAGGCAGAGAGATATTCCA
GAGGAGAAGTATTCGAATGCTTTTCTTGGTTTTGGCCCTGAAGAGTCTCA
CTTTGTGGTTGAGTTGACATATAATTATGGAGTTGATAAGTATGACATCG
GAACCGGCTTTGGGCATTTTGCTATTGCCACACCAGATGTTTACAAACTG
GTTGAGGAGATAAAGGCCAAGGGTGGAACTGTCACAAGGGAGCCTGGTCC
TGTCAAGGGTGGATCTAGTGTTATTGCTTTTGTCAAAGATCCTGATGGCT
ACCTATTTGAAATCATCCAGAGAGAGTCTACTCCTGAACCACTTTGCCAA
GTGATGCTTCGTGTGGGGGATCTTGAACGTGCGATCAAATTCTACGAAAA
GGCACTTGTGATGCAAGTGGTGAAGAAAGTTGATAGACCATAGCATAAGT
ATACCATTGCTATGATGGGATATGCTCCA
Genomic location of cLEX-4-I9  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D3007 marker 3007
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)