SGN Marker cLET-5-L17

SGN-M3017

SynonymsNone
Locus associationsNone
Derivations 
This marker was derived from EST clone SGN-C87751
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 40402)
Chromosome
2
Position
103.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
cLET-5-L17 was used as an overgo probe on plate 11 [well H2]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
ATGGCAGAAGGATTCCAGCTACAG
B sequence
ACCCTTGCAAACAGCTCTGTAGCT
AB sequence
ATGGCAGAAGGATTCCAGCTACAGAGCTGT
Marker sequence
TGCCGGAGGAGGGAAACACATGGGCTCCGATCTGGCACAAAGTGTTGGCA
TTAATGAACTTGCTGAGAGCATGATGTCTTTTAACACCAACTATAAGGAT
ACTGGTTTGTTCGGCGTGTATGCTGTTGCAAAGCCTGATTGTTTGAGTGA
TTTGTCCTACTGCATTATGCGCGAGATAAGCAAATTGTGCTACCGGGTTT
CGGATGCTGATGTGACTCGTGCTTGCAACCAGTTGAAGTCTTCTCTCATG
CTACACATTGATGGAACTAGTCCTGTTGCTGAAGACATTGNGCGTCAGCT
ACTCACATATGGCAGAAGGATTCCAGCTACAGAGCTGTTTGCAAGGGTTG
ATGCTGTGGATGCTAGCACCATCAAACGAGTTGCAAACAGATTTATCTTT
GACCAGGATGTTGCTATATCCGCGCTGGGGCCTATCCAGACACTACCTGA
TTATAACTGGTTCAGACGCAGAACCTACATGCT
Genomic location of cLET-5-L17  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D3017 marker 3017
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)