SGN Marker TG605

SGN-M302

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1700
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
TG605 image not available
Forward sequence
GGAGACAGCTTGCATGCCTGCAGAAGTGATAAGATGGATGGCGTATCTCAAAGAAGTATTAACCCCGATCTTGGTCAATAAAACTTTTGC
ATCCTCAGACATTTCTACATCCTCCTCTTGGCATCTGATGTCCAGGATTTTGCGAATTTCTTCCTCTTTGTAAGGTTGTGTAGAGATGAT
GAGCAGGCGATCAAGAAAGTCAATTGGAATCCCGTGTGGGGATCTGTAGTTTGTTCCCCGGATTGTAGTAATGCCTCTATTTGTAGCAAC
AACCAATATAGGTGCCATGTCATTCTCCAGAGCTCGGTTTAGGAAAGAGAAACACTCAATGTCAAGCATATGTACTTCGTCAATGAAGAG
GACACCGGGCACAATCTCTGCCTTCCCTTCCTCCCTCCACTCAGCAACCTTGGTATCTATTTGTTCTCTCACTTCAGCACGAATCTCACC
AGTATCACCCGTAAATAGTGCTAAAAATCCCTGTGTTCTGAAATTGAGATGAGCTGATTAACATATTTAATCTAGTGAAGTAG
Reverse sequence
GGAGACAGCTTGCATGCCTGCAGAAGTGATAAGATGGATGGCGTATCTCAAAGAAGTATTAACCCCGATCTTGGTCAATAAAACTTTTGC
ATCCTCAGACATTTCTACATCCTCCTCTTGGCATCTGATGTCCAGGATTTTGCGAATTTCTTCCTCTTTGTAAGGTTGTGTAGAGATGAT
GAGCAGGCGATCAAGAAAGTCAATTGGAATCCCGTGTGGGGATCTGTAGTTTGTTCCCCGGATTGTAGTAATGCCTCTATTTGTAGCAAC
AACCAATATAGGTGCCATGTCATTCTCCAGAGCTCGGTTTAGGAAAGAGAAACACTCAATGTCAAGCATATGTACTTCGTCAATGAAGAG
GACACCGGGCACAATCTCTGCCTTCCCTTCCTCCCTCCACTCAGCAACCTTGGTATCTATTTGTTCTCTCACTTCAGCACGAATCTCACC
AGTATCACCCGTAAATAGTGCTAAAAATCCCTGTGTTCTGAAATTGAGATGAGCTGATTAACATATTTAATCTAGTGAAGTAGGAAAC
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1641631e-137302 (56.7% of RFLP seq)+
SGN-U1641631e-137302 (56.1% of RFLP seq)-
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 40110)
Chromosome
3
Position
54.50 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8840)
Chromosome
3
Position
49.30 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
TG605 was used as an overgo probe on plate 4 [well D4]

Plausible BAC Matches:   P331B12,   P173M07,   P176B05,   P044D05,   P203E19,   P047M14

 Overgo Sequences

A sequence
CTACATCCTCCTCTTGGCATCTGA
B sequence
CGCAAAATCCTGGACATCAGATGC
AB sequence
CTACATCCTCCTCTTGGCATCTGATGTCCA
Marker sequence
GGAGACAGCTTGCATGCCTGCAGAAGTGATAAGATGGATGGCGTATCTCA
AAGAAGTATTAACCCCGATCTTGGTCAATAAAACTTTTGCATCCTCAGAC
ATTTCTACATCCTCCTCTTGGCATCTGATGTCCAGGATTTTGCGAATTTC
TTCCTCTTTGTAAGGTTGTGTAGAGATGATGAGCAGGCGATCAAGAAAGT
CAATTGGAATCCCGTGTGGGGATCTGTAGTTTGTTCCCCGGATTGTAGTA
ATGCCTCTATTTGTAGCAACAACCAATATAGGTGCCATGTCATTCTCCAG
AGCTCGGTTTAGGAAAGAGAAACACTCAATGTCAAGCATATGTACTTCGT
CAATGAAGAGGACACCGGGCACAATCTCTGCCTTCCCTTCCTCCCTCCAC
TCAGCAACCTTGGTATCTATTTGTTCTCTCACTTCAGCACGAATCTCACC
AGTATCACCCGTAAATAGTGCTAAAAATCCCTGTGTTCTGAAATTGAGAT
GAGCTGATTAACATATTTAATCTAGTGAAGTAG
Genomic location of TG605  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D302 marker 302
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)