SGN Marker cLER-17-N11

SGN-M3023

SynonymsNone
Locus associationsNone
Derivations 
This marker was derived from EST clone SGN-C71424
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 40344)
Chromosome
2
Position
124.00 cM
Confidence
CF(LOD3)
Protocol
RFLP
Subscript
A


Tomato-EXPEN 2000

Map: Tomato-EXPEN 2000   
Map version
52 (location: 40343)
Chromosome
2
Position
124.00 cM
Confidence
CF(LOD3)
Protocol
CAPS


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 35663
Forward primer (5'-3')
AACTTGTCTGGACCCATTGC
Digested band sizes (using RsaI)
Solanum pennellii LA716: 550
Solanum lycopersicum LA925: 750
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TAAATGACCGCCTTTCTTGC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 828
Solanum pennellii LA716: 828
Approximate temperature
55°C
  
PCR data   Exp. ID 34
Forward primer (5'-3')
Unknown
Digested band sizes (using RsaI)
Solanum lycopersicum LA925: 750
Solanum pennellii LA716: 550
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
Unknown
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 828
Solanum pennellii LA716: 828
Approximate temperature
55°C
  
Overgo hybridization and physical mapping 
cLER-17-N11 was used as an overgo probe on plate 10 [well G11]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
ACAACTTGTCTGGACCCATTGCTC
B sequence
CACTGGCTAATCTCCGGAGCAATG
AB sequence
ACAACTTGTCTGGACCCATTGCTCCGGAGA
Marker sequence
TTTCAGTCATAACAACTTGTCTGGACCCATTGCTCCGGAGATTAGCCAGT
GCAAGTTGCTGACTTATGTTGATCTCAGCAGGAACCAACTTTCGGGTGAG
ATTCCTACTGAGATCACAGGTATGAGAATACTCAACTACTTGAATTTATC
GCGAAACCACTTAGTTGGGAGTATTCCTGCCCCTATTTCTAGTATGCAGA
GTTTAACTTCTGTTGATTTCTCGTATAACAACTTTTCTGGTTTAGTTCCT
GGAACCGGGCAATTTAGTTATTTCAATTACACCTCATTTCTAGGCAATCC
AGATCTTTGCGGACCCTATTTGGGCCCTTGCAAAGAGGGCGTTGTTGATG
GGGTTAGTCAACCTCACCAACGAGGAGCCTTAACGCCTTCGATGAAG
Genomic location of cLER-17-N11  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D3023 marker 3023
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)