SGN Marker cLEF-2-A11

SGN-M3027

SynonymsNone
Locus associationsNone
Derivations 
This marker was derived from EST clone SGN-C25855
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 40312)
Chromosome
2
Position
142.50 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
cLEF-2-A11 was used as an overgo probe on plate 11 [well B6]

Plausible BAC Matches:   P210F17,   P219K15

 Overgo Sequences

A sequence
CAGTTTTACGCTGCCTGTACCTTC
B sequence
AACTGAGGATACCACCGAAGGTAC
AB sequence
CAGTTTTACGCTGCCTGTACCTTCGGTGGT
Marker sequence
CAGAAACCACCAGTGTTCCCAACAACAACCTCATTATTCCGGCACCTAAT
GAACCTGGCAAGATCGAGATGTACTCCCCGCAGTTTTACGCTGCCTGTAC
CTTCGGTGGTATCCTCAGTTGTGGTCTCACTCACATGGCTGTCACTCCAC
TCGATCTCGTCAAATGTAACATGCAGATTGACCCTGCGAAATACAAGAGC
ATATCGTCTGGATTCGGCGTCCTTCTTAAGGAGCAAGGTCCCAGGGGATT
CTTCAGGGGATGGGTTCCTACCCTGTTAGGTTACAGTGCTCAAGGTGCAT
GCAAGTTTGGATTCTATGAATTCTTCAAGAAGTACTACTCGGACCTCGCC
GGAGCAGAAAATGCTGCAAAATACAAAACTCTGATATACCTTGCTGGTTC
TGCATCTGCTGAAGTGATTGCAGATATTGCTCTTTGCCCATTTGAAGCTG
TAAAGGTTCGTGTTCAGACACAGACTGGTTTCGCTAGGGGATTGTCTGAT
GGATTGCCGAAATTTGTTAGATCTGAAGGTCCCATGGGCTTGTACAAAGG
CTTGGTACCTCTTTGGGGACGTCAGATTCCATATACAATGATGAAGTTTG
CGTCCTTTGAGACTATTGTGGAGATGATCTACAAGCATGCAGTCCCAAAG
CCT
Genomic location of cLEF-2-A11  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D3027 marker 3027
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)