SGN Marker cLPT-5-E7

SGN-M3030

SynonymsNone
Locus associationsNone
Derivations 
This marker was derived from EST clone SGN-C110514
Mapped locations  
Map: Tobacco N. tomentosiformis   
Map version
91 (location: 46795)
Chromosome
9
Position
74.60 cM
Confidence
F(LOD3)
Protocol
PCR


Tobacco N. tomentosiformis

Map: Tobacco N. acuminata   
Map version
89 (location: 46541)
Chromosome
9
Position
65.30 cM
Confidence
F(LOD3)
Protocol
PCR


Tobacco N. acuminata

Map: Pepper-COSII   
Map version
58 (location: 41643)
Chromosome
4
Position
16.60 cM
Confidence
F(LOD3)
Protocol
CAPS


Pepper-COSII

PCR data   Exp. ID 43599
Forward primer (5'-3')
ACAGCCAAGTCGAAGTCCTC
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
TTGGCATATGTACTCACGGTTCGAT
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 40471)
Chromosome
3
Position
15.00 cM
Confidence
F(LOD3)
Protocol
CAPS


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 35668
Forward primer (5'-3')
ACAGCCAAGTCGAAGTCCTC
Digested band sizes (using TaqI)
Solanum pennellii LA716: 1400
Solanum lycopersicum LA925: 600+800
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
CCCAAGGGGGTTTAAGAGAA
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1800
Solanum lycopersicum LA925: 1800
Approximate temperature
55°C
  
PCR data   Exp. ID 39
Forward primer (5'-3')
Unknown
Digested band sizes (using TaqI)
Solanum pennellii LA716: 1400
Solanum lycopersicum LA925: 600+800
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
Unknown
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1800
Solanum lycopersicum LA925: 1800
Approximate temperature
55°C
  
Overgo hybridization and physical mapping 
cLPT-5-E7 was used as an overgo probe on plate 2 [well B3]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
AGAATTCTGTGCTGCCACCGCTTG
B sequence
TTAGTCTCGGGATCAGCAAGCGGT
AB sequence
AGAATTCTGTGCTGCCACCGCTTGCTGATC
Marker sequence
GCTAACAGCCAAGTCGAAGTCCTCTAGCGATGATTTAGAGAATTCTGTGC
TGCCACCGCTTGCTGATCCCGAGACTAATGTCTATAGCCTTGGGGTTCTT
TTAATAGAAATAATTTCTGGCAAATCACCTTATTCAGAAGAAAAAGAGTC
TCTTCTAAACTGGGCGGCACAATATTTACATCACGACAAGCAGAATATCG
CCTCTTTGGTGGATCCATCATTGAAGTCTTTCAAGAATAATGAGCTTATG
GTTATTTGTGAAGTAATTGAACAATGCCTTCAAGAAGATCCAAGGAAGAG
ACCAACTATCAAAGAATCCATTGATAAATTAAGGGAAGCAATTGATGTAT
CGCCAAATGCTGCAGTTCCAAAGCTTTCTCCTCTGTGGTGGGCTGAACTC
GAGTTGTTATCCAGCGAGGCAGCGTGATCCAGCTTATACTTTGTCCGTCT
ACTTTGTAAGTTTGAGTACGTACGTGTTGTTTTACTACGTATGAATACGA
GAATACATCATTTCTCTTAAACCCCCTTGGGGTAGTTGGATCTAACTATC
CTCTACATCTAATTATGAACTATATTGGG
Genomic location of cLPT-5-E7  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D3030 marker 3030
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)