SGN Marker cLEC-10-O18

SGN-M3034

SynonymsNone
Locus associationsNone
Derivations 
This marker was derived from EST clone SGN-C1111
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 40272)
Chromosome
3
Position
73.10 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
cLEC-10-O18 was used as an overgo probe on plate 7 [well E6]

Plausible BAC Matches:   P101C24,   P222F01,   P290P23,   P098B03

 Overgo Sequences

A sequence
CGCGAATTTACCCAACAAAGGCAG
B sequence
CGTGCTGCTCCATTTACTGCCTTT
AB sequence
CGCGAATTTACCCAACAAAGGCAGTAAATG
Marker sequence
GAAGCAGATCATGTAGGTTTCAGTTGCTCTACTAGTGGAGGTGCTGCTAG
CAGAGGCATTTTGGGACCATTTGGTGTCATAGTAATTGCTGATCAAACGC
TATCTGAGCTAACGCCAGTTTACTTTTACATTTCTAAAGGAGCTGATGGT
CGTGCAGAGACTCACTTCTGTGCTGATCAAACTAGATCCTCTGAGGCTCC
GGGAGTTGGTAAACAAGTTTATGGTAGTTCAGTACCTGTGTTGGACGGTG
AAAAACATTCAATGAGATTATTGGTGGATCACTCAATTGTGGAGAGCTTT
GCTCAAGGAGGAAGAACAGTCATAACATCGCGAATTTACCCAACAAAGGC
AGTAAATGGAGCAGCACGACTCTTTGTTTTCAACAATGCCACAGGGGCTA
GCGTTACTGCCTCCGTCAAGATTTGGTCACTTGAGTCAGCTAATATTCAA
TCCTTCCCTTTGCAAGACTTGTAATCTTCTTTATTTCGNTTTTTTTTTCT
TTTTCATTTGAAGGTTATTTCACCGACGTCCCATCAAGAAAGGGAAGAGG
GAGATCAATATATGTAGTGTTATTCGCCCTACCTTAGGATTAGATGTCAT
CTAGCAATGTCAAATCTAGTAGAGTATACAATGTATGGGTT
Genomic location of cLEC-10-O18  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D3034 marker 3034
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)