Notice: The FTP site is available again. We apologize for any inconvenience.

SGN Marker cTOB-8-I8

SGN-M3035

SynonymsNone
Locus associationsNone
Derivations 
This marker was derived from EST clone SGN-C122998
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 40502)
Chromosome
3
Position
75.10 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
cTOB-8-I8 was used as an overgo probe on plate 8 [well B2]

Plausible BAC Matches:   P289P02,   P115L10

 Overgo Sequences

A sequence
TGTGTAAGCCGCGAATTCCCGATT
B sequence
GACGTTGGAAGGGTAAAATCGGGA
AB sequence
TGTGTAAGCCGCGAATTCCCGATTTTACCC
Marker sequence
CCGTCCTTCCTTGTAGTCATCCTTTGTGTAAGCCGCGAATTCCCGATTTT
ACCCTTCCAACGTCGTGTGACCAAAATCGATTGTGTCATTACTCGTATTT
TTATGCTGATGGTACTCTGGCTGAGGGTAATCTTGTCCGTGAAAAAATTA
CATTTTCACGTTCCCAAAGTACCCCTCCTTTGATTCTTGGTTGCGCTACC
GAGTCCGATGATGCTGAGGGTATTTTGGGTATGAATCTTGGAAGGTTCTC
ATTTGCCTGCCAAGCCAAGGTACAAAAGTTCTCGTATTGCGTGCCGATTC
GACAAGGTAACCATACGGTTAAACCTACCGGAACATTCTACCTATGGCAA
AACCCGAATTCACATAC
Genomic location of cTOB-8-I8  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D3035 marker 3035
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)